Дисплазия соединительной ткани у детей симптомы: Страница не найдена — Северо-Западный государственный медицинский университет имени И. И. Мечникова

Содержание

Ренокардиальный синдром у ребенка с ненаследственной дисплазией соединительной ткани | Черкасов Н.С., Давыдова О.В., Дербенева Л.И., Луценко Ю.А.

Актуальность

Соединительная ткань присутствует во всех органах человека и составляет 45–50% от общей массы тела. Она активно участвует в обеспечении большинства физиологических функций и процессов. Актуальность изучения развития ренокардиального синдрома у детей с дисплазией соединительной ткани (ДСТ) определяется достаточно широкой распространенностью последней, нарастанием ее частоты с возрастом и недостаточной изученностью ренокардиального синдрома [1].

Клинико-патогенетические, диагностические, а также прогностические аспекты ДСТ в последнее время активно изучаются. Под ДСТ сегодня понимают гетерогенную группу полигенно наследуемых заболеваний мультифакторной природы, в основе патогенеза которых могут быть нарушения синтеза и/или распад белков внеклеточного матрикса, способствующие проградиентному течению процесса.

ДСТ может иметь наследственную моногенную природу, развитие процесса возможно и в результате неблагоприятного воздействия факторов окружающей среды на эмбрион и плод при наличии генетической предрасположенности. В связи с этим ранее было принято выделять дифференцированную и недифференцированную формы ДСТ [2].

В настоящий момент используется унифицированная терминология, основанная на рекомендациях проекта «Наследственные и многофакторные нарушения соединительной ткани у детей» [3]. Согласно данному проекту целесообразно выделять наследственные нарушения соединительной ткани и ДСТ ненаследственного характера. Ко второй форме можно отнести «мягкие мутации», микроделеции с невыраженной клинической картиной. К ДСТ, ранее называемой «недифференцированная», относили патологию, сочетающую несколько фенотипических признаков без определенного синдрома.

К наследственным (моногенным) относятся ДСТ, ранее именовавшиеся «дифференцированные дисплазии», имеющие определенную симптоматику и тип наследования: синдром Марфана, синдром Элерса — Данло, синдром Стиклера, несовершенный остеогенез, пролапс митрального клапана, MASS-синдром (включает пролапс митрального клапана, миопию, умеренное расширение аорты, стрии на коже). Однако вне зависимости от причины при любом варианте ДСТ страдают несколько систем или органов, что объективно проявляется внешними фенотипическими признаками и симптомами со стороны внутренних органов [4].

Поражение нескольких органов и систем у пациента с ДСТ позволяет применять понятие коморбидности. Под коморбидностью в настоящее время понимают сочетание двух или более самостоятельных заболеваний, не являющихся осложнением друг друга. При ДСТ основным патогенетическим механизмом формирования сочетанной патологии является нарушение функции соединительной ткани, дисметаболизм белков внеклеточного матрикса. Параллельное поражение систем и органов, спровоцированное одним патологическим фактором, обозначается как причинная коморбидность [5].

Понятие коморбидности существует уже около 40 лет, и в терапевтической практике давно используется индекс коморбидности Чарлсона для прогнозирования риска осложнений и летального исхода при наличии у больного нескольких заболеваний. В педиатрии на проблему коморбидности обратили внимание лишь в последние годы [6], коморбидные заболевания выявляются у детей уже с момента рождения [7].

Замечено, что сочетания заболеваний чаще формируются под влиянием сходных патогенетических факторов либо одно заболевание возникает под влиянием другого. Наличие коморбидности негативно влияет на течение основного заболевания, создает проблемы в диагностике, увеличивает финансовые затраты на больного. Следовательно, коморбидность необходимо учитывать при выработке оптимальной стратегии ведения таких больных [5–7].

Особое внимание в аспекте коморбидности заслуживает ренокардиальный синдром, поскольку при ДСТ часто встречается сочетанное поражение почек и сердца [8, 9]. Ренокардиальный синдром используется для характеристики сочетанных поражений, при которых дисфункция сердца и почек возникает одновременно [10]. Наглядным примером развития и диагностики ренокардиального синдрома при ДСТ является представленное ниже клиническое наблюдение.

Клиническое наблюдение

Мальчик Г., 6 лет. Из анамнеза известно, что ребенок рожден от 4-й беременности, возраст матери на момент родов — 41 год. Беременность протекала неблагоприятно, на фоне миомы матки, несостоятельности рубца на матке, хронического пиелонефрита, преэклампсии. На 12–13-й неделе беременности мать перенесла острое респираторное заболевание. Роды состоялись на 39-й неделе гестации, родоразрешение проведено путем кесарева сечения.

Масса ребенка при рождении 3820 г, длина тела 54 см. Оценка по шкале Апгар: 8/8 баллов. Физиологическая желтуха не отмечалась. Период адаптации протекал в целом благоприятно. Эксклюзивное грудное вскармливание сохранялось до 3 мес., далее применялось смешанное кормление, прикормы вводились с 6 мес. Психомоторное развитие на первом году без особенностей. С раннего возраста отмечаются отставание в массе и росте, циклические ацетонемические состояния. Респираторными заболеваниями болел не часто, вакцинация проводилась по возрасту, без побочных реакций.

Из семейного анамнеза известно, что у матери имеется хронический пиелонефрит, хронический аутоиммунный тиреоидит, у бабушки по линии матери — гипотиреоз.

С 1-го года ребенок находился на диспансерном учете у нефролога, регулярно наблюдался амбулаторно, проходил стационарное обследование в отделении уронефрологии ГБУЗ АО «ОДКБ им. Н.Н. Силищевой» в 2016 и 2018 гг. В 2019 г. был выставлен диагноз: «Тазовая дистопия правой почки. Дисметаболическая нефропатия. Нейрогенная дисфункция мочевого пузыря. Вторичный хронический пиелонефрит».

В 2018 и 2019 гг. обследован в отделении педиатрии ГБУЗ АО «ОДКБ им. Н.Н. Силищевой», выставлен диагноз: «Хронический гастродуоденит. Вторичная билиарная дисфункция. Субклинический гипотиреоз». Амбулаторно наблюдался у гастроэнтеролога с диагнозом: хронический гастродуоденит, хронический панкреатит; консультирован кардиологом и генетиком, ими выявлены множественные признаки ДСТ. Для уточнения генеза патологии у данного пациента, а также уточнения функционального состояния внутренних органов (в частности, почек) было принято решение направить ребенка на обследование в Научно-исследовательский клинический институт педиатрии имени академика Ю.Е. Вельтищева ФГАОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России (Москва), там в отделении нефрологии ребенок находился с 20.02.2020 по 11.03.2020.

При поступлении жалобы на ночное недержание мочи (энурез). Объективно состояние удовлетворительное, сознание ясное. Масса тела 18 кг (перцентиль 3–10%), индекс массы тела 13,61 кг/м2, рост 115 см (перцентиль 10–25%). Площадь поверхности тела 0,76 м2. Физическое развитие ниже среднего, дисгармоничное за счет дефицита массы.

Визуально отмечаются микроаномалии: длинная глазная щель, длинные ресницы, широкий кончик носа, асимметрия ушных раковин, нарушение прикуса. Кожные покровы бледные. Периферические лимфатические узлы без особенностей. Обращает на себя внимание нарушение осанки (грудной кифоз 1-й степени.), вальгусная девиация локтевых суставов, симптом гипермобильности межфаланговых суставов. Со стороны дыхательной системы без патологии. Ритм сердца неправильный, частота сердечных сокращений (ЧСС) 82–100 в минуту, артериальное давление (АД) на левой руке 99/45 мм рт. ст. В пищеварительной системе патологических симптомов на момент осмотра не выявлено. Отмечались явления дизурии в виде ночного недержания мочи.

Таким образом, при проведении объективного осмотра были обнаружены 8 внешних фенотипических признаков ДСТ: длинная глазная щель, длинные ресницы, широкий кончик носа, асимметрия ушных раковин, нарушение прикуса, вальгусная девиация локтевых суставов, симптом гипермобильности межфаланговых суставов, нарушение осанки (грудной кифоз 1-й степени).

Лабораторно в общем анализе крови, при исследовании показателей кислотно-щелочного состояния, в биохимическом анализе крови отклонений не выявлено. Иммунохимия на маркеры ВИЧ, гепатита и сифилиса — результат отрицательный. В копрологическом анализе выявлялась выраженная амилорея и креаторея, умеренная стеаторея за счет мыл, реакция на скрытую кровь отрицательная. В общем анализе мочи обращало на себя внимание измененное соотношение белок/креатинин (200 мг/г при норме <80 мг/г), микроскопически определялась слизь и большое количество плоского эпителия. В пробе Зимницкого суточный диурез 570 мл (ниже возрастной нормы), плотность мочи 1005–1023.

УЗИ брюшной полости: печень не увеличена, эхогенность обычная, эхоструктура паренхимы однородная, сосуды не расширены. Желчный пузырь: сокращен после приема пищи. Поджелудочная железа: контур ровный, обычной эхогенности, эхоструктура неоднородная, размеры: головка 2 см, тело 1,6 см, хвост 1,9 см. Заключение: реактивный панкреатит.

По результатам опроса, объективному статусу, УЗИ брюшной полости, результатам биохимического исследования врачом-гастроэнтерологом выставлен диагноз: «Реактивный панкреатит, нельзя исключить наличие гастродуоденита». Даны рекомендации по дальнейшему обследованию и наблюдению.

При проведении ЭКГ (с клиноортостатическим положением и физической нагрузкой) отмечалась резко выраженная синусовая аритмия по типу «тахи-бради», ЧСС 111–62 в минуту, при ритме 62 удара в минуту — признаки укорочения интервала QT (327 мс при норме >350 мс), нарушение адаптации QT к ЧСС.

Эхо-КГ с допплерометрией: в средней части межпредсердной перегородки регистрируется турбулентный поток, направленный слева направо, шириной до 19 мм. Конечный диастолический размер левого желудочка (ЛЖ) 4,1 см, конечный систолический размер ЛЖ 3,4 см, правый желудочек 1,6 см, левое предсердие 3,5 см, межжелудочковая перегородка 0,5 см, толщина задней стенки ЛЖ 0,5 см, фракция выброса 60%, фракция укорочения 42%, в полости ЛЖ лоцируется дополнительная хорда. Градиент давления на легочной артерии 4,9 мм рт. ст., митральная регургитация (+) — (++). Систолическое давление в правом желудочке 29 мм рт. ст. Заключение: обнаружены открытое овальное окно (рис. 1), дополнительная хорда ЛЖ, пролапс митрального клапана 1-й степени, регургитация 1-й степени.


При суточном мониторинге АД зарегистрированы признаки лабильной систоло-диастолической артериальной гипертензии в дневное время и лабильной диастолической гипертензии ночью с повышением индексов времени гипертензии для систолического АД (САД) до 31% днем, а для диастолического АД (ДАД) до 27% днем и до 34% ночью. Средние показатели АД в дневное и ночное время в пределах нормы. Максимальный подъем САДдо 148 мм рт. ст. в 20:13 при ЧСС 115 в минуту. Максимальный подъем ДАД

до 94 мм рт. ст. в 19:06 при ЧСС 107 в минуту. Циркадные колебания АД не нарушены — диппер.

Ребенок осматривался врачом-кардиологом, клинический диагноз: «Малые аномалии развития сердца. Открытое овальное окно, дополнительная хорда ЛЖ. Пролапс митрального клапана 1-й степени. Ренальная артериальная гипертензия 1-й степени, лабильная форма».

Проведенное обследование демонстрирует наличие у данного пациента висцеральных кардиологических признаков ДСТ: дополнительной хорды ЛЖ, пролапса митрального клапана с регургитацией, открытого овального окна и нарушения ритма сердца в виде синусовой аритмии по типу «тахи-бради».

УЗИ почек с ультразвуковой допплерографией: правая почка в типичном месте не определяется, визуализируется справа в малом тазу, левая — в поясничной области на 1,5 см ниже XII ребра, ротирована, подвижность левой почки 2,3% (при норме 1,8% от роста), контур обеих почек неровный. Цветовое допплеровское картирование: правая почка — кровоток несколько обеднен, левая — до капсулы, раннее ветвление почечной артерии, центральный эхокомплекс справа пересечен паренхимой, слева расщеплен, лоханка слева — смешанного типа, до и после микции 0,6 см. Слева почечный индекс 0,52% при норме 0,2–0,3%, справа 0,26%. Мочевой пузырь без особенностей. Заключение: «Тазовая дистопия правой почки, нельзя исключить удвоение чашечно-лоханочной системы (ЧЛС) справа. Левая почка ротирована, увеличена в объеме, повышенной подвижности».

При УЗИ выявлены висцеральные нефрологические признаки ДСТ: удвоение ЧЛС в аномально расположенной (тазовая дистопия) правой почке, повышенная подвижность левой почки.

При проведении экскреторной урографии тазовая дистопия правой почки подтверждена, левая почка ротирована, увеличена в объеме (рис. 2).


Заключение уролога по данным обследования: «Тазовая дистопия правой почки, удвоение ЧЛС справа. Вторичный обструктивный пиелонефрит, период клинико-лабораторной ремиссии. Хроническая болезнь почек I стадии. Нейрогенная дисфункция мочевого пузыря по гиперрефлекторному типу. Вторичный энурез».

Наличие признаков ДСТ послужило основанием для консультации генетика для уточнения генеза ДСТ. Объективно отмечены низкие показатели физического развития, нарушение осанки (грудной кифоз), вальгусная девиация локтевых суставов, симптом гипермобильности межфаланговых суставов. Кожа эластичная, умеренной растяжимости. Микропризнаки: длинная глазная щель, длинные ресницы, широкий кончик носа, асимметрия ушных раковин, нарушение прикуса. Проведено дополнительное обследование: тандемная масс-спектрометрия — данных за наследственные аминоацидопатии, органические ацидурии и дефекты митохондриального бета-окисления не выявлено; моча на органические кислоты — концентрация органических кислот в пределах нормы; ферментодиагностика — активность лизосомных ферментов в пределах референсных значений. С учетом данных обследования генетиком выставлен клинический диагноз: ненаследственная ДСТ средней степени тяжести.

Таким образом, у данного пациента отмечается сочетание фенотипических (в количестве 8) и висцеральных (в количестве 6) признаков ДСТ. Из внутренних (висцеральных) признаков преобладают изменения в сердце и почках, причем имеет место сочетание диспластических изменений с пороком развития почки. Сочетание симптомов ДСТ в сердце и почках встречается довольно часто [8, 9]. Ассоциация поражения почек и сердца у ребенка может рассматриваться как вариант ренокардиального (кардиоренального) синдрома (континуума), когда дисфункция любого органа в этой паре приводит к развитию или усугублению патологии другого органа. Коморбидность почечной и кардиальной патологии известна и достаточно неплохо изучена в терапевтической практике, в педиатрии рассматривалось формирование вариантов кардиоренального синдрома при сочетании пороков сердца и почек у детей, развитие кардио­васкулярной патологии у детей с хронической болезнью почек [10–12]. Применительно к вышеописанному клиническому наблюдению можно сделать заключение о том, что у нашего пациента ренокардиальный синдром реализуется в виде ренальной артериальной гипертензии, пока еще в лабильной форме и без явного поражения органов-мишеней.

Заключение

Данное клиническое наблюдение демонстрирует сочетание у ребенка патологии нескольких органов, предположительно формируется причинная коморбидность, и большая часть диагнозов связана с ДСТ, признаки которой выявлены при объективном и инструментальном обследовании и подтверждены генетиком. Однако вопрос истинной причины заболеваний пока остается открытым, ребенку требуется регулярное наблюдение у большого количества специалистов, дополнительное лабораторное и инструментальное обследование, дальнейший поиск возможных наследственных причин патологии.

Все это создает дополнительные сложности в организации ведения такого пациента на амбулаторно-поликлиническом этапе, требует разработки индивидуальных схем обследования, лечения, диспансеризации и реабилитации. Неясным выглядит и прогноз у такого «трудного пациента», поскольку обнаруженный ренокардиальный синдром являет собой уже осложненную форму коморбидности. Актуальность проблемы ренокардиального синдрома при коморбидности обусловлена трудностями диагностики и возможным развитием осложнений в виде утраты функций заинтересованных органов.

Сведения об авторах:

Черкасов Николай Степанович — д.м.н., профессор кафед­ры госпитальной педиатрии с курсом последипломного образования ФГБОУ ВО Астраханский ГМУ Минздрава России; 414000, Россия, г. Астрахань, ул. Бакинская, д. 121; ORCID iD 0000-0001-9532-5446.

Давыдова Оксана Владимировна — к.м.н., доцент кафед­ры госпитальной педиатрии с курсом последипломного образования ФГБОУ ВО Астраханский ГМУ Минздрава России; 414000, Россия, г. Астрахань, ул. Бакинская, д. 121; ORCID iD 0000-0001-5616-7342.

Дербенева Лариса Ивановна — к.м.н., доцент кафедры гос­питальной педиатрии с курсом последипломного образования ФГБОУ ВО Астраханский ГМУ Минздрава России; 414000, Россия, г. Астрахань, ул. Бакинская, д. 121; ORCID iD 0000-0002-5416-9042.

Луценко Юлия Анатольевна — аспирант кафедры госпитальной педиатрии с курсом последипломного образования ФГБОУ ВО Астраханский ГМУ Минздрава России; 414000, Россия, г. Астрахань, ул. Бакинская, д. 121; ORCID iD 0000-0001-6336-7887.

Контактная информация: Давыдова Оксана Владимировна, e-mail: [email protected] Прозрачность финансовой деятельности: никто из авторов не имеет финансовой заинтересованности в представленных материалах или методах. Конфликт интересов отсутствует. Статья поступила 04.03.2021, поступила после рецензирования 21.03.2021, принята в печать 15.04.2021.

About the authors:

Nikolay S. Cherkasov — Doct. of Sci. (Med.), Рrofessor of the Department of Hospital pediatrics with the Course of Postgraduate Education, Astrakhan State Medical University; 121, Bakinskaya str., Astrakhan, 414000, Russian Federation; ORCID iD 0000-0001-9532-5446.

Oksana V. Davydova — Cand. of Sci. (Med.), associate professor of the Department of Hospital pediatrics with the Course of Postgraduate Education, Astrakhan State Medical University; 121, Bakinskaya str., Astrakhan, 414000, Russian Federation; ORCID iD 0000-0001-5616-7342.

Larisa I. Derbeneva — Cand. of Sci. (Med.), associate professor of the Department of Hospital pediatrics with the Course of Postgraduate Education, Astrakhan State Medical University; 121, Bakinskaya str., Astrakhan, 414000, Russian Federation; ORCID iD 0000-0002-5416-9042.

Yuliya A. Lutsenko — postgraduate student of the Department of Hospital pediatrics with the Course of Postgraduate Education, Astrakhan State Medical University; 121, Bakinskaya str., Astrakhan, 414000, Russian Federation; ORCID iD 0000-0001-6336-7887.

Contact information: Oksana V. Davydova, e-mail: [email protected] Financial Disclosure: no authors have a financial or property interest in any material or method mentioned. There is no conflict of interests. Received 04.03.2021, revised 21.03.2021, accepted 15.04.2021.



.

Это страшное слово дисплазия | Москва

Дисплазия соединительной ткани – это состояние, при котором имеет место врожденное нарушение строения и функции соединительной ткани

Признаки дисплазии соединительной ткани столь многолики, что пациенты с данной патологией могут наблюдаться одновременно несколькими специалистами поликлиники – кардиологом, неврологом, окулистом, отоларингологом и др. Степень распространенности дисплазии соединительной ткани (ДСТ) в общей популяции людей на сегодняшний день не известна, поскольку данные, приводимые в научной литературе, варьируют в широком диапазоне (от 14 до 85 %). Но специалисты считают, что эта патология имеет преимущественно женское лицо и передается по наследству.

Что же такое дисплазия соединительной ткани?

Дисплазия соединительной ткани – это состояние, при котором имеет место врожденное нарушение строения и функции соединительной ткани.

Степень распространенности дисплазии соединительной ткани (ДСТ) в общей популяции людей на сегодняшний день не известна, поскольку данные, приводимые в научной литературе, варьируют в широком диапазоне (от 14 до 85 %). Но специалисты считают, что эта патология имеет преимущественно женское лицо и передается по наследству.

Все дело в коллагене.

По своей значимости соединительная ткань занимает в организме особое место, составляя около 50% всей массы тела. Распространенная по всему организму соединительная ткань представлена в дерме кожи, подкожной клетчатке, сухожилиях, связках, суставных хрящах, межпозвонковых дисках, костях, клапанах сердца, кровеносных сосудах, дентине и эмали зубов, в структурах глаза и т.д. Нет ни одного органа и системы, которые не содержали бы основные структурные элементы соединительной ткани. А болезнь возникает из-за молекулярных изменений структурных элементов соединительной ткани, преимущественно коллагена.

Каковы же симптомы дисплазии соединительной ткани?

Уважаемому читателю, вероятно, хорошо эти признаки знакомы. Это

  • боли в спине,
  • гиперподвижность суставов,
  • суставные боли,
  • плоскостопие,
  • растяжки на коже,
  • варикозное расширение вен,
  • близорукость,
  • боль в грудной клетки,
  • сердцебиение,
  • лабильность пульса и артериального давления,
  • дыхательные расстройства,
  • косметические дефекты и др.

И задача врача общей практики за частной симптоматикой увидеть системную патологию.

Пролапс митрального клапана

В настоящее время наиболее изученным проявлением синдрома дисплазии соединительной ткани сердца является пролапс митрального клапана (ПМК). Проблема ПМК привлекает к себе пристальное внимание врачей из-за большой частоты в популяции и повышенного риска развития серьезных осложнений. Большинство исследователей предполагают, что в развитии ПМК наряду со «слабостью» соединительной ткани немаловажную роль играет дефицит магния. С дефицитом магния связывают полиморфизм и выраженность клинической симптоматики у этих пациентов. Поэтому лечение магнием рассматривается как специфическая, учитывающая генез заболевания, терапия ПМК.

Таким образом, дисплазия соединительной ткани, сопровождающаяся выраженными клиническими и структурными нарушениями, изменениями функционального состояния сердечно-сосудистой системы, уменьшением содержания магния в волосах, снижает качество жизни и трудоспособность пациентов. Обладает прогредиентным течением и утяжеляет течение сопутствующей патологии (легочной, сердечно-сосудистой, почечной и т.д.).

Поэтому раннее выявление отклонений от нормы и профилактические мероприятия, направленные на коррекцию нарушений, способствуют благоприятному прогнозу.

Запись на прием к врачу терапевту

Обязательно пройдите консультацию квалифицированного специалиста в клинике «Семейная».

 

Чтобы уточнить цены на прием врача терапевта или другие вопросы пройдите по ссылке ниже

ПРОЯВИ НЕКЛАСИФІКОВАНОЇ ДИСПЛАЗІЇ СПОЛУЧНОЇ ТКАНИНИ ЗАЛЕЖНО ВІД ВІКУ. ПРОГНОЗ

Резюме. У статті наведено огляд літератури, присвячений клінічним проявам celebrex 200 mg дисплазії сполучної тканини залежно від віку. Максимальне зростання ознак дисплазії сполучної тканини визначено у шкільному віці. У старшому віці відзначено труднощі диференціювання інволютивних змін і про­явів дисплазії сполучної тканини.

Резюме. В статье приводится обзор литературы, посвященной клиническим проявлениям дисплазии соединительной ткани в зависимости от возраста. Максимальный рост признаков дисплазии соединительной ткани определен в школьном возрасте. В старшем возрасте указаны трудности дифференцировки инволютивных изменений и проявлений дисплазии соединительной ткани.

Довольно длительное время считалось, что неклассифицированная (недифференцированная) дисплазия соединительной ткани (ДСТ) в основном проявляется в детском и юношеском возрасте [5, 19, 29, 30]. Однако по мере накопления данных исследований пришло понимание, что ДСТ имеют место во всех возрастных группах [13, 22, 40]. В процессе роста и развития организма накапливаются дефекты в системе соединительной ткани (СТ): белках внеклеточного матрикса, ферментах, клетках [29]. С учетом полигенности ДСТ, многочисленности структур, вовлеченных в патологический процесс, отмечают, что конкретные клинические проявление ДСТ могут меняться с возрастом. И время появления клинических признаков наследственных нарушений соединительной ткани (ННСТ) зависит от закономерностей генной экспрессии, пенетрантности генов и факторов внешней среды. Важно, что чем большее число признаков ДСТ имеется у конкретного индивидуума, чем раньше они проявляются, тем достовернее диагноз ДСТ и хуже прогноз [13].

Признаки ДСТ в возрасте новорожденности минимальны и проявляются отставанием в росте, недостаточной массой тела, долихостеномелией, маленькой верхней челюстью, дисплазией тазобедренных суставов и т.д. [19]. Рост признаков ДСТ наблюдается в дошкольном возрасте, отличий по полу не наблюдается. Максимальный рост признаков происходит в возрасте 11–14 лет [30, 36]. В этот же период появляются различия в частоте признаков ДСТ в зависимости от пола. После «возрастного рубежа» — 16–17 лет — нарастание частоты и выраженности признаков ДСТ идет медленнее.

Влияние половых гормонов на метаболизм СТ известно [29]. Так, тестостерон стимулирует фибропластические реакции, ускоряя синтез СТ, обусловливая ее бόльшую прочность и меньшую растяжимость. Вероятно, именно поэтому при гиперандрогении у девушек can lipitor cause forgetfulness «слабость» СТ не столь выражена. Эстрогены, напротив, увеличивают количество тучных клеток, способствуя отечности СТ и формированию экссудативных реакций. Под действием женских половых гормонов происходит преждевременное созревание фибробластов и разрушение части клеток с продукцией легкорастворимого, эластичного коллагена. Так, в подростковом возрасте у девушек по сравнению с юношами отмечается более быстрое прогрессирование сколиоза. Гипермобильность суставов и кожные проявления ДСТ также чаще выявляют у девочек.

В детском и подростковом возрасте наиболее характерными проявлениями ДСТ являются разнообразные аномалии строения скелета, гипермобильность суставов, малые аномалии сердца (МАС), и прежде всего — пролапс митрального клапана (ПМК), миопия [ 2, 14, 19, 27, 36, 41].

Наибольшей чувствительностью и специфичностью для клинической диагностики ДСТ обладают костные признаки: астеническое телосложение, долихостеномелия, арахнодактилия, килевидная и воронкообразная грудная клетка, сколиоз, кифоз и лордоз позвоночника, синдром «прямой спины», плоскостопие и др. [23]. Начальные признаки скелетных деформаций формируются в 5–6-летнем возрасте. Во всех случаях воронкообразная деформация отмечается на 2–3 года раньше, чем килевидная. Обычно к 10–12 годам четко формируется деформация грудной клетки. В этом же возрасте отмечаются корригируемые деформации позвоночника. В дальнейшем выраженность и количество костно-мышечных признаков увеличивается, деформации позвоночника становятся фиксированными, не поддаются активной и пассивной коррекции.

Статический сколиоз позвоночника, развившийся в подростковом возрасте, в среднем и пожилом возрасте приводит к более ранним и выраженным дегенеративным изменениям в суставах позвонков с развитием корешкового синдрома.

С возрастом на фоне усиления выраженности деформаций скелета может страдать бронхолегочная система [33]. При развитии тугоподвижности в реберно-позвоночно-грудинных сочленениях начинает страдать торакодиафрагмальный аппарат. Последнее способствует рестриктивным нарушениям функции внешнего дыхания, которые считаются специ­фической формой диспластикозависимых нарушений и механики дыхания у лиц с ДСТ.

Поперечная распластанность стопы с подросткового и юношеского возраста в большинстве случаев приводит к hallux valgus и предрасполагает к развитию гонартроза в среднем и пожилом возрасте [22].

Гипермобильность суставов относится к явным проявлениям неклассифицированной ДСТ у детей [36, 41]. Частота выявляемости гипермобильности суставов достоверно выше среди пациентов с наличием других проявлений ДСТ, неоднородна в разных популяциях. Реже она определяется у европейцев, чаще — у индейцев. Наибольшая подвижность суставов выявляется у детей в возрасте 13–14 лет; к 25–30 годам она уменьшается в 3–5 раз. В подростковом возрасте имеется наиболее высокое содержание эластина. По-видимому, именно за счет нарастания удельного веса эластических волокон развивается типичная для подростков гипермобильность суставов, уменьшающаяся по мере взросления.

Отмечено, что у лиц, у которых имелся гипермобильный синдром, во второй половине жизни раньше и чаще, чем у лиц без такого синдрома, развиваются разнообразные поражения околосуставных мягких тканей. Такое положение объясняется тем, что на уже имеющийся дефект СТ более легко накладываются инволютивные процессы в сухожильно-связочном аппарате [22, 41].

МАС обычно диагностируют в раннем детском возрасте. Часть МАС может подвергнуться обратному развитию уже в среднем возрасте: увеличенный евстахиев клапан, пролабирующие гребенчатые мышцы в правом предсердии, ПМК, закрытие открытого овального окна, нормализация длины хорд митрального клапана и диаметра магистральных сосудов [19, 22, 37, 43]. Другие МАС сохраняются в течение жизни, и с возрастом могут приобретать самостоятельное клиническое значение, способствуя развитию патологии или становясь фактором риска кардиальной патологии: экстрасистолии при ложных хордах левого желудочка, парадоксальной эмболии при открытом овальном окне, стеноза аорты при асимметрии трехстворчатого аортального клапана, тромбоэмболических осложнений при аневризме межпредсердной перегородки. Миксоматозная дегенерация створок и хорд прогрессирует с возрастом и может являться причиной перфорации створок и/или разрыва хорд митрального клапана в старшем возрасте.

Установлены половые различия в распространенности ПМК: соотношение девочек и мальчиков в подростковом возрасте определяют как 3:1, а женщин и мужчин до 50 лет — 2:1. Прогноз при ПМК благоприятный, только в очень редких случаях при выраженной регургитации, истончении и дегенерации створок клапана показана консультация кардиохирурга.

В прошлом столетии при описании клиники ПМК как обязательную составляющую описывали «астеновегетативный» синдром [16]. Авторы объясняли причину появления этого синдрома «неполноценностью развития структур гипоталамуса», связанного с ПМК. Данное положение подтверждалось с помощью анкетирования, но не нейровизуализации. Можно предположить, что такие результаты обследования пациентов являются установочными, когда у ребенка диагностируют «заболевание сердца», а прогноз неясен вследствие недостаточности информации. К настоящему времени в клинику ПМК астенический или синд­ром вегетативной дисфункции не включается [7, 25].

Нередко в отношении МАС подчеркивается, что они могут служить причиной тромбоэмболии, инфекционного эндокардита (ИЭ). В настоящее время первичный ПМК исключен из причин, вызывающих инсульт или транзиторную ишемическую атаку [7]. В плане ИЭ хотим привести следующие данные: из 106 наблюдавшихся пациентов с ИЭ только у 4 диа­гностирован ПМК и у 1 — миксоматозная дегенерация митрального клапана [32]. Если учесть, что распространенность ПМК в популяции составляет 3–10%, до 22%, то у пациентов с ИЭ наличие ПМК, скорее всего, не является существенным фактором риска последнего.

В отношении ИЭ принципиален вопрос его профилактики. В рекомендациях Европейского общества кардиологов по инфекционному эндокардиту (2009) [39] указывается, что проведение антибиотикопрофилактики должно быть рассмотрено только у пациентов самого высокого риска развития ИЭ. Больные с ПМК с регургитацией или выраженным утолщением створок клапана относятся к пациентам среднего риска развития ИЭ. В связи с этим эксперты считают, что ввиду отсутствия доказательств эффективности профилактики ИЭ у этой категории пациентов антибиотикопрофилактика им не показана.

Синдром внезапной смерти часто включается в клинику ДСТ, особенно у людей молодого возраста, связывается с наличием ПМК, МАС. К настоящему времени признано, что ПМК — чрезвычайно редкая причина внезапной смерти [7, 11, 25, 38]. В этом плане проведено специально организованное исследование [23]. Автор наблюдала учащихся трех школ города Омска в возрасте от 7 до 17 лет (n=950), кроме этого, в течение 15 лет проводилось наблюдение 400 пациентов с ДСТ (конечными точками исследования были смерть или первичный выход на инвалидность), оценены результаты патолого-анатомического исследования 25 умерших и судебно-медицинских исследований 164 внезапно умерших людей молодого возраста (средний возраст — 27,5±3,1 года) с признаками ДСТ. Автор приходит к следующим выводам: фенотипические проявления ДСТ и биохимические нарушения, наиболее информативные в отношении наступления инвалидизации или являющиеся предвестниками ранней и внезапной смерти, располагаются в порядке убывания информативности следующим образом:

  • воронкообразная деформация грудной клетки III степени;
  • килевидная деформация корпорокостального и костального типов;
  • кифосколиоз III–IV степени;
  • воронкообразная деформация II степени;
  • уровень общего оксипролина в суточной моче >3 норм;
  • кифосколиоз II степени;
  • килевидная деформация манубриостернального типа;
  • содержание гликозаминогликанов в суточной моче >3 норм;
  • снижение индекса массы тела (<18,5).

Образцом изменений специальных видов СТ при ДСТ служат повреждения органа зрения [5, 40]. Известно частое сочетание проявлений ДСТ с миопией. Миопия проявляется в различные периоды жизни, но у большинства — в школьные годы (8–15 лет), и далее прогрессирует. В некоторых случаях может приводить к осложнению диспластикозависимых изменений — отслойке сетчатки.

Если в детском возрасте ДСТ преимущественно выступает как ведущая причина патологии, то в среднем возрасте ДСТ может выступать и как ведущая причина, так и фактором, изменяющим течение «классических» заболеваний. Наиболее вероятной патологией в среднем возрасте, при которой ДСТ является ведущей причиной, можно считать следующее [27]:

  • Ломкость костей (>2 переломов в анамнезе при падении).
  • Абдоминальные грыжи и пролапсы внутренних органов.
  • Расширение ствола легочной артерии при отсутствии клапанного или периферического легочного стеноза или другой очевидной причины, в возрасте <40 лет; обызвествление митрального кольца в возрасте <40 лет; расширение либо расслоение стенки аорты в возрасте <50 лет.
  • Спонтанный пневмоторакс.
  • Птозы органов брюшной полости и почек, поликистоз почек.
  • Аномалии формы и расположения желудка, двенадцатиперстной кишки и желчного пузыря.

Признанная градация в отношении ДСТ и возраста: при развитии определенной патологии в более молодом возрасте она, скорее всего, обусловлена ДСТ, а в более старшем — другими причинами. Эксперты [32] в некоторых случаях ограничивают вероятность связи ДСТ и некоторых заболеваний возрастом. Однако существуют и другие мнения. Так, К.Н. Милица [17] у 240 пациентов изучал связь ДСТ с возникновением грыж передней брюшной стенки в экспериментальных и клинических условиях. Автор при морфологическом исследовании выявил существенные изменения состава гликозаминогликанов, коллагена I и III типа передней брюшной стенки, которые прогрессируют по мере нарастания признаков ДСТ. Клинически это проявлялось в увеличении доли послеоперационных грыж в 6 раз, рецидивирующих грыж в 7 раз по сравнению с лицами без ДСТ. При этом одним из прогностических факторов развития после­операционных грыж автор приводит возраст >49 лет.

Сосудистый синдром, как правило, манифестирует в подростковом возрасте, прогрессируя с годами. Патология венозной системы нередко сочетается с ПМК в 78% случаев [15, 18, 34, 42].

О взаимосвязи варикозной болезни вен и некласифицированной ДСТ можно утверждать при наличии семейного анамнеза, при появлении заболевания, а также геморроя в раннем возрасте [28].

Варикозное расширение вен малого таза часто возникает в молодом возрасте, имеет прогредиентное течение. Так, эта патология у девочек в возрасте 3–17 лет отмечается в 19,4%, у женщин репродуктивного возраста — уже в 80% случаев [1, 12]. Считается, что заболевание манифестирует у девочек с врожденной слабостью СТ в пубертатном возрасте, когда под действием эстрогенов происходит физиологическая и морфологическая перестройка венозной стенки органов малого таза с дальнейшим развитием клинической картины заболевания.

Имеются разнообразные свидетельства влияния ДСТ на течение многих заболеваний и состояний у взрослых молодого и среднего возраста. Такое положение зафиксировано в отношении дуоденальных язв [26], в акушерстве и гинекологии [1, 9], при патологии бронхолегочной системы [33].

В старшем возрасте трудно дифференцировать инволютивные изменения и проявления ДСТ [22, 29]. Дифференциация их на основании клинических проявлений затруднена. Изменения СТ генетически детерминированы и при старении, и при врожденной патологии. Однако морфологические аспекты старения и ДСТ различаются. Так, при старении происходит разрастание СТ в сосудах, развивается их склероз, погибшие клетки замещаются СТ. Нарушается структура костной и хрящевой тканей, развивается деформация скелета («старческая осанка»). Уплотнение СТ ведет к клеточной гипоксии, ухудшению питания, что способствует гибели паренхиматозных элементов. При старении возрастает масса волокнистых структур, повышается плотность «упаковки» коллагена, наряду с утолщенными волокнами появляются истонченные, изменяются их тинкториальные свойства. Резистентность коллагена к воздействию ферментов (трипсина, пепсина) повышается. В макромолекуле коллагена образуются ковалентные поперечные сшивки, снижающие его растворимость, повышается содержание плохорастворимого коллагена («старческий коллаген»). При ДСТ, напротив, в молекулах коллагена уменьшено количество поперечных сшивок, он более растворимым, легко разрушается.

При старении уменьшается число эластических волокон, происходит их конденсация, разволокнение, повышается их сродство к солям кальция. При ДСТ наблюдается фрагментация эластина аорты и даже его исчезновение, объясняемое избыточным уровнем эластазы и дефицитом десмозиновых связей.

Для инволютивных сдвигов внеклеточного матрикса характерно уменьшение объема клеточных элементов; меняется их качественный состав, взаимодействие с коллагеном. При ДСТ наоборот, описывается скопление кислых мукополисахаридов.

Можно констатировать, что в настоящее время отсутствуют свидетельства того, что у лиц старших возрастных групп проявления ДСТ имеют самостоятельное клиническое значение [22]. Однако имеются многочисленные свидетельства того, что наличие признаков ДСТ, особенно их значительного числа, оказывает влияние на течение заболеваний, развивающихся в этом возрасте [3, 10, 24]. Например, в отношении течения острой церебральной патологии у лиц с ДСТ показано, что у них чаще развивается геморрагический инсульт, более выражена патология брахиоцефальных сосудов. При нарушении мозгового кровообращения достоверно в сравнении с пациентами без ДСТ отмечается более выраженная положительная динамика в виде уменьшения тяжести клинических проявлений и лучшее восстановление утраченных функций [8, 35].

Высказывается мнение, что у лиц с ДСТ артериальная гипертензия (АГ) чаще имеет черты симптоматической [5]. Как причину АГ чаще называют патологию почек (нефроптоз, гипоплазия, ротация, врожденные аномалии почечных сосудов), а также нарушение кровотока по артериям позвоночника вследствие гипоплазии или нарушения вхождения в канал шейных позвонков, дисплазии брахиоцефальных сосудов [3, 4, 20, 21]. Однако подтверждения такого положения нам не удалось выявить [31].

Можно предположить, что, поскольку основным морфофункциональным признаком ДСТ является повышение эластичности тканей, в том числе и сосудов, и, соответственно, уменьшение их жесткости, то течение эссенциальной АГ на фоне ДСТ должно быть более благоприятным. Для выяснения этого момента нами обследовано 35 пациентов с АГ І–ІІ стадии з разной степенью повышения артериального давления высокого и очень высокого риска 47,9±7,7 года. У наблюдаемых лиц выявлен нефроптоз в 15% случаев. Изучались показатели упругоэластичных свойств сосудов эластического типа на примере общей сонной артерии: модули Петерсона, Юнга, линейной растяжимости, коэффициент податливости, индекс жесткости методом сонографии высокого разрешения [6]. Установлено, что у пациентов с АГ и признаками ДСТ изучаемые показатели существенно отличаются в сторону повышения эластичности и уменьшения жесткости от таковых у пациентов с АГ, но без ДСТ. Необходимо подчеркнуть, что нами определена корреляционная зависимость между показателями жесткости и наличием нефроптоза. Эти связи слабо отрицательные, но достигали достоверной величины (р<0,05). Мы делаем вывод, что у пациентов с АГ и ДСТ эластичность сосудов (как основного патогенетического звена АГ) повышена, жесткость — снижена. Однако АГ у них все равно развивается. Иначе говоря, механизмы реализации повышения АД у лиц с и без ДСТ отличаются. И при этом присутствуют определенные элементы симптоматической нефрогенной АГ.

При анализе строения общих сонных и позвоночных артерий по данным сонографии высокого разрешения нами установлено следующее [6]. У пациентов с АГ и ДСТ, в отличие от лиц без ДСТ, достоверно чаще отмечались S-образная извитость и гипоплазии позвоночных артерий, и реже — общей сонной. Следовательно, пациенты с АГ и фенотипическими, висцеральными, признаками ДСТ отличаются от лиц соответствующего возраста без ДСТ направленностью патологии экстракраниальных артерий. Последнее, безусловно, оказывает влияние на течение и прогноз АГ. Такой вывод обоснован, поскольку есть доказательства, что патология экстракраниальных сосудов в значительной степени связана с риском развития сердечно-сосудистых заболеваний.

Таким образом, клинические проявления и прогноз ДСТ зависит от возраста. В детском и подростковом возрасте существенны проявления самой ДСТ. У лиц в возрасте старше 20 лет сохраняется клиническое значение проявлений ДСТ как таковых. При этом вступает в силу другое правило — наличие ДСТ оказывает влияние на течение других, интеркуррентных относительно ДСТ, заболеваний. В старшей возрастной категории превалирует влияние ДСТ на течение основной патологии. Еще раз подчеркнем, что морфологические основы ДСТ и старения различны.

Литература

1. Адамян Л.В., Смольнова Т.Ю. (2010) Диагностика и тактика ведения больных с дисплазией соединительной ткани в акушерстве и гинекологии. РМЖ, 6: 41–46.
2. Белозеров Ю.М., Османов И.М., Магомедова Ш.М. (2011) Диагностика и классификация пролапса митрального клапана у детей и подростков. Кардиология, 3: 63—67.
3. Верещагина Г.Н., Висковатых М.А., Махмудян Д.А. и др. (2004) Дисплазия соединительной ткани и формирование артериальной гипертензии. Кардиоваск. терапия и профилактика, 4(2): 86.
4. Верещагина Г.Н., Махмудян Д.А. (2008) Почки при системной дисплазии соединительной ткани. Мед. вестн. Северного Кавказа, 2: 87–89.
5. Верещагина Г.Н. (2008) Системная дисплазия соединительной ткани. Клинические синдромы, диагностика, подходы к лечению. Метод. пособие для врачей. Новосибирский государственный медицинский университет, 37 с.
6. Дєдова В.О. (2011) Показники пружно-еластичних властивостей судин у хворих на артеріальну гіпертензію з дисплазією сполучної тканини. Актуальні питання медицини і фармації: 13–14.
7. Денисов И.Н., Шевченко Ю.Л., Кулаков В.И. (ред) (2003) Клинические рекомендации для практических врачей, основанные на доказательной медицине. Пер. с англ. ГЭОТАР-Медиа, Москва, 1242 с.
8. Дмитриев А.Н., Пизова Н.В. (2007) Дисплазия соединительной ткани и острые нарушения мозгового кровообращения (обзор литературы). Журн. неврологии и психиатрии им. С.С. Корсакова, 19: 66–72.
9. Дорохова Л.Н. (2011) Состояние иммунитета и течение инфекционного процесса у беременных с недифференцированными формами дисплазии соединительной ткани, носителей семейства герпес-вирусов. Мед. иммунология, 2: 175–180.
10. Земцовский Э.В., Лобанов М.Ю., Давтян К.У. (2009) Диспластические синдромы и фенотипы как предикторы пароксизмов фибрилляции предсердий у пациентов со стабильным течением ишемической болезни сердца. Вестн. аритмологии, 56: 14–19.
11. Земцовский Э.В., Малев Э.Г., Луневаа Е.Б. (2011) Наследственные нарушения соединительной ткани и внезапная сердечная смерть. Вестн. аритмологии, 63: 61–65.
12. Ильина И.Ю., Доброхотова Ю.Э., Титченко И.П. и др. (2009) Варикозное расширение вен малого таза у женщин как одно из проявлений дисплазии соединительной ткани. Рос. вестн. акушера-гинеколога, 2: 39–42.
13. Кадурина Т.И., Горбунова В.Н. (2009) Дисплазия соединительной ткани. Руководство для врачей. ЭЛБИ, Санкт-Петербург, 714 с.
14. Крючкова О. Н., Лутай Ю. А. (2011) Современные методы диагностики и лечения пролапса митрального клапана. Крым. журн. эксперимент. и клин. медицины, 2(2): 44–47.
15. Кубышкин В.Ф., Захарьян Е. А. (2007) Биохимические, морфологические и допплерометрические критерии дисплазии соединительной ткани при варикозной болезни вен нижних конечностей. Кровообіг та гемостаз, 1: 85–89.
16. Мартынов А.И., Степура О.Б., Остроумова О.Д. и др. (1998) Пролапс митрального клапана. Ч. ІІ. Нарушения ритма и психологический статус. Кардиология, 2: 74–79.
17. Милиця К.М. (2009) Методологія виявлення хворих на дисплазію сполучної тканини серед хворих хірургічного стаціонару, як захід попередження гриж черевної стінки. Укр. cipro penicillin allergy мед. альманах, 3: 103–105.
18. Мозес В.Г., Мозес К.Б. (2006) Клинические проявления системного поражения соединительной ткани у женщин раннего репродуктивного возраста с варикозным расширением вен малого таза. Бюл. сиб. медицины, 1: 87–90.
19. Мутафьян О. А. (2005) Пороки и малые аномалии сердца у детей и подростков. Издательский дом СПбМАПО, Санкт-Петербург, 480 с.
20. Нечаева Г.И., Викторова И.А., Дёмина Г.И. и др. (2002) Диспластикозависимая и ассоциированная патология почек — один из механизмов формирования артериальной гипертензии при дисплазии соединительной ткани. Сиб. консилиум, 1: 15–18.
21. Нечаева Г.И., Викторова И.А., Дёмина Г.И. и др. (2003) Маркеры патологии брахеоцефальных сосудов при артериальной гипертензии у молодых. В кн.: Конгресс ассоциации кардиологов стран СНГ, 18–20 сентября, 2003 г., Санкт-Петербург, с. 204–205.
22. Нечаева Г.И. Викторова И.А., Калинина И.Ю. (2004) Диагностика дисплазии соединительной ткани у лиц среднего и пожилого возраста в практике семейного врача. Рос. сем. врач, 2(8): 47–54.
23. Нечаева Г.И., Конев В.П., Викторова И.А. (2004) Методология курации пациентов с дисплазией соединительной ткани семейным врачом в аспекте профилактики ранней и внезапной смерти. Рос. мед. вести, 3 (IX): 25–32.
24. Нечаева Г.И., Яковлев В.М., Друк И.В. и др. (2008) Нарушения ритма сердца при недифференцированной дисплазии соединительной ткани. Леч. врач, 6: 43–47.
25. Прокоп Д., Кюваниеми Х., Тромп Дж. (2002) Наследственные болезни соединительной ткани. В кн.: Т.Р. Харрисон. Внутренние болезни. Практика, Москва, 2646–2660.
26. Рудой А.С., Москалев А.В., Апчел В.Я. (2010) Роль цитокинов в иммуноморфогенезе эрозивных и хронических гастритов, ассоциированных с наследственными нарушениями соединительной ткани. Вестн. Рос. воен.-мед. академ., 3: 20—25.
27. Российские рекомендации (2009) Наследственные нарушения соединительной ткани. Кардиоваск. терапия и профилактика, 6(8): 24 с.
28. Свистунов А.А., Царев О.А., Маслякова Г.Н. и др. (2009) Клиническое течение варикозной болезни у больных с различной степенью выраженности дисплазии соединительной ткани. Саратов. науч.-мед. журн., 2(5): 261–266.
29. Серов В.В., Шехтер А.Б. (1981) Соединительная ткань (функциональная морфология и общая патология). Медицина, Москва, 312 с.
30. Сидорович О.В., Горемыкин В.И., Елизарова С.Ю. и др. (2011) Особенности развития и течения заболеваний, ассоциированных с дисплазией соединительной ткани, у детей пубертатного возраста. Саратов. науч.-мед. журн., 1(7): 123–126.
31. Сиренко Ю.Н. (2011) Гипертоническая болезнь и артериальные гипертензии. Издатель Заславский А.Ю., Донецк, 288 с.
32. Федорова Т.А., Яковлев В.Н., Левина О.Н. и др. (2008) Современные проблемы и патоморфоз инфекционного эндокардита (по данным многопрофильного стационара). Клин. геронтология, 11: 11–16.
33. Филипенко П.С., Кучмаева Т.Б. (2008) Особенности клинического течения экспираторного стеноза трахеи и главных бронхов у больных с синдромом недифференцированной дисплазии соединительной ткани. Мед. вестн. Север. Кавказа, 2: 80–82.
34. Царегородцев А.Г. (2009) Дисплазия соединительной ткани: патология сосудов, причины внезапной смерти. Сиб. мед. журнал, 1: 34–39.
35. Чижов П.А., Пизова Н.В., Дмитриев А.Н. и др. (2011) Клинические особенности острых нарушений мозгового кровообращения у лиц молодого возраста с синдромом недифференцированной дисплазии соединительной ткани. Журн. неврологии и психиатрии им. С.С. Корсакова, 2: 19–24.
36. Шостак Н.А., Клименко А.А., Правдюк Н.Г. и др. (2011) Гипермобильный синдром и патология мягких тканей. Фарматека, 9: 29–32.
37. ACC/AHA (2006) Guidelines for the management of patients with valvular heart disease: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines. J. Am. Coll. Cardiolog., 48: 1–148.
38. Anders S., Said S., Schulz F. (2007) Mitral valve prolapse syndrome as cause of sudden death in young adults. Forensic. Sci. Int., 2–3(171): 127—130.
39. ESC (2009) Guidelines on the prevention, diagnosis, and treatment of infective endocarditis of the European society of cardiology (new version 2009). Eur. Heart J., 30: 2369—2413.
40. Hakim A., Clunie G., Hag I. (2008) Oxford Handbook of Rheumatology, 2 ed. Oxford University Press, 606 p.
41. Malfait F., Hakim A.J., De Paepe A. (2006) The genetic basis of the joint hypermobility syndrome. Rheumatology, 45: 502–507.
42. Roldan J.F., O’Rourke R.A., Roberts W.C. (2008) The connective tissue diseases and the cardiovascular system. Hurst’s The Heart, 88: 2033–2052.
43. Scordo K.A. (2007) Medication use and symptoms in individuals with mitral valve prolapse syndrome. Clin. Nurs. Res., 1(16): 58—71.

Адрес для переписки:

Доценко Николай Яковлевич

69096, Запорожье, бульв. Винтера, 20

ГУ «Запорожская медицинская академия

последипломного образования МЗ Украины»,

кафедра кардиологии

Е-mail: [email protected]

Проявления митохондриальной дисфункции у детей с дисплазией соединительной ткани и хроническим гастродуоденитом | Иванова

1. Брин И.Л., Неудахин Е.В., Дунайкин М.Л. Карнитин в педиатрии: исследования и клиническая практика. М.: Медпрактика-М, 2015; 112. [Brin I.L., Neudahin E.V., Dunajkin M.L. Carnitine in Pediatrics: research and clinical practice. Moscow: Medpraktika-M, 2015; 112 (in Russ.)]

2. Ивянский С.А., Балыкова Л.А., Щекина Н.В., Аритки- на А.А., Варлашина К.А., Широкова А.А. и др. Нарушения соединительной ткани у детей и подростков, занимающихся спортом. Consilium Medicum. Педиатрия 2016; 4: 94–101. [Ivyanskiy S.A., Balykova L.A., SHCHekina N.V., Aritkina A.A., Varlashina K.A., SHirokova A.A. et al. Disorders of connective tissue in children and adolescents involved in sports. Consilium Medicum. Pediatriya 2016; 4: 94–101 (in Russ.)]

3. Николаева Е.А. Митохондриальные болезни у детей: клинические проявления, возможности диагностики и лечения. Учебное пособие. М., 2017; 88. [Nikolaeva E.A. Mitochondrial diseases in children: clinical manifestations, diagnostics and treatment. Tutorial. Moscow, 2017; 88 (in Russ.)]

4. Кадурина Т.И., Гнусаев С.Ф., Аббакумова Л.Н., Алимова И.Л., Антонова Н.С., Апенченко Ю.С. и др. Наследственные и многофакторные нарушения соединительной ткани у детей: алгоритмы диагностики, тактика ведения. Проект Российских рекомендаций. Педиатрия. Журнал им. Г.Н. Сперанского 2014; 93(5): Приложение: 1–40. [Kadurina T.I., Gnusaev S.F., Abbakumova L.N., Alimova I.L., Antonova N.S., Apenchenko Yu.S. et al. Inherited and multifactorial disorders of connective tissue in children: diagnostic algorithms and management. The project of the Russian recommendations. Pediatriya. Zhurnal im. G.N. Speranskogo ( Pediatria. Journal named after G.N. Speransky) 2014: 93(5): Suppl: 1–40 (in Russ.)]

5. Полиорганные нарушения при дисплазиях соединительной ткани у детей. Алгоритмы диагностики. Тактика ведения. Российские рекомендации. Часть 2. Вопросы детской диетологии 2017; 15(3): 47–70. [Multiorgan disorders in connective tissue dysplasia in children. Algorithms of diagnostics. Tactics of reference. Russian recommendations. Part 2. Voprosy detskoi dietologii 2017; 15 (3): 47–70 (in Russ.)]

6. Кадурина Т.И., Горбунова В.Н. Дисплазия соединительной ткани: Руководство для врачей. СПб: Элби-СПб 2009; 704. [Kadurina T.I., Gorbunova V.N. Connective tissue dysplasia: a Guide for physicians. SPb.: EHlbi-SPb, 2009; 704 (in Russ.)]

7. Чемоданов В.В., Краснова Е.Е. Особенности течения заболеваний у детей с дисплазией соединительной ткани. Иваново: ГОУ ВПО ИвГМА Росздрава, 2009; 140. [Chemodanov V.V., Krasnova E.E. Peculiarities of disease in children with connective tissue dysplasia. Ivanovo: GOU VPO IvGMA Roszdrava, 2009; 140 (in Russ.)]

8. Арсентьев В.Г., Арзуманова Т.И., Асеев М.В., Баранов В.С., Калядин С.Б., Никифорова И.Д., Шабалов Н.П. Полиорганные нарушения при ДСТ у детей и подростков. Педиатрия 2009; 88(1): 135–138. [Arsent’ev V.G., Arzumanova T.I., Aseev M.V., Baranov V.S., Kalyadin S.B., Nikiforova I.D., Shabalov N.P. Multiple organ disorders in connective tissue dysplasia in children and adolescents. Pediatriya 2009; 88(1): 135–138 (in Russ.)]

9. Апенченко Ю.С., Басалаева Н.В., Капустина Л.В., Иванова И.И. Клинические и биохимические признаки дисплазии соединительной ткани у детей с гастроэзофагеальной рефлюксной болезнью. Вестник Ивановской медицинской академии 2014; 19(3): 17–19. [Apenchenko Yu.S., Basalaeva N.V., Kapustina L.V., Ivanova I.I. Clinical and biochemical signs of connective tissue dysplasia in children with gastroesophageal reflux disease. Vestnik Ivanovskoi meditsinskoi akademii 2014; 19(3): 17–19 (in Russ.)]

10. Иванова И.И., Гнусаев С.Ф., Апенченко Ю.С., Капустина Л.В., Герасимов Н.А., Солдатова И.А. Особенности проявлений заболеваний пищеварительного тракта у детей с дисплазией соединительной ткани. Вопросы современной педиатрии 2012; 11(5): 50–55. [Ivanova I.I., Gnusaev S.F., Apenchenko Yu.S., Kapustina L.V., Gerasimov N.A., Soldatova I.A. Features of diseases of the digestive tract in children with connective tissue dysplasia. Voprosy sovremennoi pediatrii 2012; 11(5): 50–55 (in Russ.)]

11. Смирнова Е.В., Лобанов Ю.Ф., Скударнов Е.В. Особенности течения эрозивного гастродуоденита у детей с дисплазией соединительной ткани. Вопросы современной педиатрии 2006; 5(4): 122–129. [Smirnova E.V., Lobanov Yu.F., Skudarnov E.V. Peculiarities of erosive gastroduodenitis in children with connective tissue dysplasia. Voprosy sovremennoi pediatrii 2006; 5(4): 122–129 (in Russ.)]

12. Демин В.Ф., Ключников С.О., Ключникова М.А. Значение соединительнотканных дисплазий в патологии детского возраста. Вопросы современной педиатрии 2005; 4(1): 50–56. [Demin V.F., Klyuchnikov S.O., Klyuchnikova M.A. The value of connective tissue dysplasia in childhood pathology. Voprosy sovremennoi pediatrii 2005; 4(1): 50–56 (in Russ.)]

13. Трутнева Л.А., Чемоданов В.В. Особенности гастродуоденальных заболеваний у детей с недифференцированной дисплазией соединительной ткани. Педиатрия. Журнал им. Г.Н. Сперанского 2010; 89(2): 12–17. [Trutneva L.A., Chemodanov V.V. Peculiarities of gastroduodenal diseases in children with undifferentiated dysplasia of connective tissue. Pediatriya. Zhurnal im. G.N. Speranskogo ( Pediatria. Journal named after G.N. Speransky) 2010; 89(2): 12–17 (in Russ.)]

14. Рахматуллина З.А., Выхристюк О.Ф., Русакова В.Д. Дис- плазии соединительной ткани и полиорганная патология у детей. Мед помощь 2008; 5: 29–31. [Rahmatullina Z.A., Vyhristyuk O.F., Rusakova V.D. Connective tissue dysplasia and multiple organ pathology in children. Med pomoshch’ 2008; 5: 29–31 (in Russ.)]

15. Сухоруков В.С. Очерки митохондриальной патологии. М.: Медпрактика-М, 2011; 288. [Suhorukov V.S. Study of mitochondrial pathology. Moscow: Medpraktika-M, 2011; 288 (in Russ.)]

16. Баедилова М.Т., Суменко В.В., Сухоруков В.С., Лебедькова С.Е., Трусова О.Ю. Эффективность энерготропной терапии при нарушении клеточного энергообмена у детей с пролапсом митрального клапана Российский вестник перинатологии и педиатрии 2017; 62(1): 74–80. [Baedilova M.T., Sumenko V.V., Suhorukov V.S., Lebed’kova S.E., Trusova O.Yu. The effectiveness of energotropic therapy in violation of cellular energy exchange in children with mitral valve prolapse. Rossiyskiy Vestnik Perinatologii i Pediatrii ( Russian Bulletin of Perinatology and Pediatrics) 2017; 62(1): 74–80 (in Russ.)] DOI: 10.21508/1027-4065-2017-62-1-74-80

17. Думова С.В., Чугунова О.Л. Внутриклеточные энергетические нарушения у недоношенных детей с задержкой внутриутробного развития и их коррекция. Практика педиатра 2013; 1: 68–69. [Dumova S.V., Chugunova O.L. Intracellular energy disorders in premature infants with intrauterine growth retardation and their correction. Praktika pediatra (Current Pediatrics) 2013; 1: 68–69 (in Russ.)]

18. Неудахин Е.В. Целесообразность использования препаратов карнитина при лечении хронических расстройств питания у детей. Практика педиатра 2015; 2: 48–52. [Neudahin E.V. The feasibility of using preparations of carnitine in the treatment of chronic eating disorders in children. Praktika pediatra ( Current Pediatrics) 2015; 2: 48–52 (in Russ.)]

19. Иванова И.И., Гнусаев С.Ф., Коваль Н.Ю., Герасимов Н.А., Солдатова И.А. Метаболические аспекты недифференцированной дисплазии соединительной ткани у детей. Российский вестник перинатологии и педиатрии 2012; 57(4): 103–111. [Ivanova I.I., Gnusaev S.F., Koval’ N.Yu., Gerasimov N.A., Soldatova I.A. Metabolic aspects of undifferentiated connective tissue dysplasia in children. Rossiyskiy Vestnik Perinatologii i Pediatrii ( Russian Bulletin of Perinatology and Pediatrics) 2012; 57(4): 103–111 (in Russ.)]

20. Parich S., Goldstein A., Koenig M.K., Scaglia F., Enns G.M., Saneto R. et al. Diagnosis and management of mitochondrial disease: a consensus statement from the Mitochondrial Medicine Society. J Genet Med 2015; 17(9): 689–701. DOI: 10.1038/gim.2014.177

21. Иванова И.И., Гнусаев С.Ф., Ильина А.А. Клинические проявления нарушений клеточного энергообмена при соматических заболеваниях у детей. Российский вестник перинатологии и педиатрии 2018; 63(2): 27–33. DOI: 10.21508/1027-4065-2018-63-2-27-33 [Ivanova I.I., Gnusaev S.F., Il’ina A.A. Clinical manifestations of cellular energy exchange disorders in somatic diseases in children. Rossiyskiy Vestnik Perinatologii i Pediatrii (Russian Bulletin of Perinatology and Pediatrics) 2018; 63(2): 27–33 (in Russ.)]

22. Каламбет Е.И., Османов И.М., Сухоруков В.С., Шабельникова Е.И., Хавкин А.И. Нарушения клеточного энергообмена и их коррекция при заболеваниях органов пищеварения у детей. Вопросы практической педиатрии 2012; 2: 69–72. [Kalambet E.I., Osmanov I.M., Suhorukov V.S., Shabel’nikova E.I., Khavkin А.I. Violation of cellular energy metabolism and their correction in diseases of the digestive system in children. Voprosy prakticheskoi pediatrii 2012; 2: 69–72 (in Russ.)]

23. Зиганшина А.А., Сухоруков В.С., Булатов В.П. Митохондриальная дисфункция у детей с рефлюкс-эзофагитом. Российский вестник перинатологии и педиатрии 2017; 62(2): 88–92. DOI: 10.21508/1027-4065-2017-62-2-88-93 [Ziganshina A.A., Suhorukov V.S., Bulatov V.P. Mitochondrial dysfunction in children with reflux esophagitis. Rossiyskiy Vestnik Perinatologii i Pediatrii (Russian Bulletin of Perinatology and Pediatrics) 2017; 62(2): 88–92 (in Russ.)]

24. Ключников С.О., Ильяшенко Д.А., Ключникова М.С. Обоснование применения L-карнитина и коэнзима Q10 у подростков. Вопросы современной педиатрии 2008; 7(4): 102–104. [Klyuchnikov S.O., Il’yashenko D.А., Klyuchnikovа M.S. The rationale for the use of L-carnitine and coenzyme Q10 in adolescents. Voprosy Sovremennoi Pediatrii (Current Pediatrics) 2008; 7(4): 102–104 (in Russ.)]

25. Кадурина Т.И., Аббакумова Л.Н. Оценка степени тяжести недифференцированной дисплазии соединительной ткани у детей. Медицинский вестник Северного Кавказа 2008; 2: 15–21. [Kadurina T.I., Abbakumova L.N. Assessment of severity of undifferentiated connective tissue dysplasia in children. Meditsinskii vestnik Severnogo Kavkaza 2008; 2: 15–21 (in Russ.)]

26. Иванова И.И., Гнусаев С.Ф., Сухоруков В.С. Опыт применения препарата L-карнитина у детей с ХГД и ДСТ. Вопросы практической педиатрии 2018; 13(6): 72–78. DOI: 10.20953/1817-7646-2018-6-72-78 [Ivanova I.I., Gnusaev S.F., Suhorukov V.S. Experience with L-carnitine in children with chronic gastroduodenitis and connective tissue dysplasia. Voprosy prakticheskoi pediatrii 2018; 13(6): 72–78 (in Russ.)]

Медицинский вестник Северного Кавказа :: Научно-практический журнал

[ДСТ в педиатрии]
Нестеренко Зоя Васильевна;

Изучены особенности клинического течения и формирования осложнений бронхиальной астмы (БА) у детей с проявлениями дисплазии соединительной ткани (ДСТ).

Под наблюдением находилось 118 детей с БА в возрасте от 1 года до 18 лет. Дисплазия соединительной ткани выявлена у 80 % пациентов; 68,1 % больных имели признаки неклассифицируемого фенотипа дисплазии, 20,8 % – элерсоподобного фенотипа, 11,1 % – марфаноподобного фенотипа. У 29,7 % детей с бронхиальной астмой выявлена внебольничная пневмония, значительно удлинившая респираторные симптомы астмы, связь частоты её возникновения с элерсоподобным и марфаноподобным фенотипами оценена как очень сильная (rxy>0,9). Самым частым осложнением астмы у детей с проявлениями дисплазии соединительной ткани определена легочная гипертензия, у половины из них отмечен пневмофиброз, у трети – легочные буллы. Установлен высокий коэффициент корреляции (rxy>0,9) между количеством сформировавшихся осложнений у детей с бронхиальной астмой и выраженностью проявлений дисплазии соединительной ткани. Вовлечение нескольких органных систем в патологический процесс у пациентов с бронхиальной астмой и дисплазией соединительной ткани значительно затрудняет раннюю диагностику астмы, ухудшает прогноз. Выявленные особенности клинического течения БА у детей с признаками дисплазии соединительной ткани позволят уменьшить число диагностических ошибок.

Скачать

Список литературы:
1. Балаболкин, И. И. Аллергическая заболеваемость у детей и подростков в современных экологических условиях / И. И. Балаболкин, Р. Н. Терлецкая / Педиатрия. – 2014. – Т. V, № 2. – С. 40–47.
2. Болезни органов дыхания у детей / под ред. В. К. Таточенко. – М., 2012. – 480 с.
3. Кадурина, Т. И. Дисплазия соединительной ткани / под ред. Т. И. Кадуриной, В. Н. Горбуновой. – Санкт- Петербург : Элби, 2009. – 714 с.
4. Наследственные нарушения структуры и функции соединительной ткани: Российские национальные рекомендации / под ред. Э. В. Земцовского. – Москва, 2009. – 66 с.
5. Национальная программа «Бронхиальная астма у детей. Стратегия лечения и профилактика». – 3-е изд., испр. и доп. – М., 2012. – 182 с.
6. Наследственные и многофакторные нарушения соединительной ткани у детей. Алгоритмы диагностики, тактика ведения. Проект Российских рекомендаций // Педиатрия. – 2014. – Т. 93, № 5. – 38 с.
7. Нестеренко, З. В. Особенности болезней органов дыхания у детей с дисплазией соединительной ткани / З. В. Нестеренко, А. А. Грицай. – Харьков : «Щедра садиба плюс», 2014. – 205 с.
8. Охотникова, Е. Н. Новые предложения GINA-2006 по диагностике и лечению бронхиальной астмы у детей / Е. Н. Охотикова, К. В. Меллина, Е. И. Усова // Астма та алергія. – 2007. – № 2. – С.145.
9. Чучалин, А. Г. Пневмония / А. Г. Чучалин, А. И. Синопальников, Л. С. Страчунский. – Москва : Мед. информ. агентство, 2006. – 462 с.
10. Юлиш, Е. И. Принципы диагностики и лечения бронхиальной астмы у детей на фоне различного течения респираторного хламидиоза / Е. И. Юлиш, Г. С. Гадецкая, А. Г. Степанова // Современная педиатрия. – 2006. – № 3. – С. 52–55.
11. Global Atlas of Asthma. EAACI, 2013. – 179 р.
12. International Consensus on Pediatric Asthma Allergy. – 2012. – Vol. 67, № 8. – Р. 976–997.

Ключевые слова: дети, бронхиальная астма, дисплазия соединительной ткани

Генетический скрининг в семье пациента с синдромом дисплазии соединительной ткани и новым патогенным вариантом гена FBN1

Введение

Дисплазия соединительной ткани (ДСТ) — группа генетически детерминированных заболеваний, обусловленных дефектами волокнистых структур и основного вещества соединительной ткани и приводящих к нарушению формообразования органов и систем [1]. У больных с ДСТ повышен риск развития внезапной смерти, обусловленной, прежде всего, патологическими изменениями сердечно-сосудистой системы (разрыв аорты, разрыв аневризмы сосудов головного мозга, острая сердечная недостаточность вследствие нарушений ритма сердца и других причин и т.д.) [2]. Учитывая широкую распространенность ДСТ среди популяции (1 случай на 5—47 человек) и частое поражение при этом сердечно-сосудистой системы, раннее выявление этой патологии является актуальной и социально значимой задачей в плане профилактики внезапной смерти лиц с признаками ДСТ [1].

В зависимости от этиологического фактора, ДСТ подразделяют на дифференцированные, в которые входят наследственные нарушения соединительной ткани (ННСТ) (моногенные ДСТ), такие как синдром Марфана (СМ), синдром Элерса-Данлоса, несовершенный остеогенез и др., недифференцированные (полигенные) ДСТ. На сегодняшний момент описано более 30 генов, связанных с ННСТ [3]. В случаях недифференцированных ДСТ заболевание носит полигенно-мультифакторный характер (заболевание с наследственной предрасположенностью), когда имеют место мутации большого количества генов, а случайная перекомбинация аллелей от отца и матери каждый раз приводит к формированию нового уникального генотипа. Нутрициальные факторы, прежде всего дефицит витаминов, макро- и микроэлементов, являются одной из основных причин, способствующих развитию ДСТ [1].

Дифференциальная диагностика между ННСТ и полигенными ДСТ затруднена даже для специалистов, что обусловлено их выраженным клиническим полиморфизмом. Под маской недифференцированных ДСТ сегодня скрывается значительное количество генетически неоднородных моногенных ННСТ, вызванных «мягкими» мутациями и протекающих со стертой клинической картиной, либо еще не диагностированные формы [1, 4]. Применение молекулярно-генетической диагностики способствует решению этой проблемы. Для улучшения эффективности скрининга целых семей и разработки программ профилактики и лечения, в которых крайне нуждаются такие пациенты, необходимо выявлять конкретный генетический дефект, вызывающий развитие заболевания [1, 4].

В настоящей работе представлен клинический случай 41-летнего пациента с симптомами ДСТ, обратившегося в НМИЦ ПМ для обследования, в результате которого при проведении экзомного секвенирования был выявлен новый патогенный вариант гена FBN1 с последующим семейным скринингом и медико-генетическим консультированием.

Описание клинического случая

Пробанд, мужчина 41 года, обратился к кардиологу в НМИЦ ПМ с жалобами на перебои в работе сердца. После кардиологического обследования пациент был направлен на консультацию к врачу-генетику.

Анамнез болезни: с детства обращал на себя внимание высокий рост (школьная форма для 1 класса была куплена на рост пятиклассника), с 17 лет прогрессировала миопия. С 19 лет пациента стали беспокоить отечность голеней и стоп, боли в голенях, развивающиеся в вечерние часы. В 30 лет была проведена двусторонняя флебэктомия вен нижних конечностей.

Семейный анамнез: данных за ранее диагностированные наследственные заболевания не было; по данным предоставленной медицинской документации, у сына 3 лет — воронкообразная деформация грудной клетки, плосковальгусные стопы.

Данные осмотра: астеническое телосложение; рост — 198 см, масса тела — 83 кг, ИМТ — 21,2 кг/м2; арахнодактилия кистей (положительные тесты большого пальца и тест запястья) (рис. 1), сандалевидные стопы, сколиоз грудного отдела позвоночника, килевидная асимметрия грудной клетки, гиперэластичность кожи и гиперподвижность суставов, готическое небо, скученность зубов, множественные «папиросные» рубцы и стрии на коже; дыхание в легких везикулярное, частота дыхания (ЧД) — 18/мин; тоны сердца ясные, аритмичные, шумов нет, частота сердечных сокращений (ЧСС) — 82 уд/мин; АД — 120 и 80 мм рт.ст.; живот мягкий, безболезненный; печень не увеличена; селезенка не пальпируется; стул оформленный, со склонностью к запорам; моча светлая, мочеиспускание безболезненное; щитовидная железа без особенностей; пульсация на артериях нижних конечностей сохранена; пациент ориентирован в пространстве и времени, контактен, очаговой симптоматики нет, миопия (2,5 диоптрии).

Рис. 1. Арахнодактилия кистей (положительные тесты большого пальца и тест запястья пациента с СМ (41 год).
а — тест большого пальца Steinberg — согнутый I палец выступает за мягкие ткани кисти; б — тест запястья Walker-Murdoch: при обхватывании запястья другой рукой I и V пальцы соединяются друг с другом.

Результаты обследования

При ЭКГ были зарегистрированы синусовая брадикардия (ЧСС — 54 уд/мин), нормальное положение электрической оси сердца, предсердные экстрасистолы, предсердные экстрасистолы. Холтеровское мониторирование ЭКГ: средняя ЧСС — 62 уд/мин, 1804 наджелудочковых экстрасистол. Рентгенография органов грудной клетки: очаговых или инфильтративных теней в легких не выявлено. ЭхоКГ: аневризма корня аорты (диаметр на уровне синусов Вальсальвы — 57 мм, диаметр на уровне сино-тубулярного гребня — 48 мм), истончение стенок корня аорты, аортальная недостаточность 0—1-й степени, гемодинамически незначимый пролапс (на 5 мм) митрального клапана, митральная недостаточность 1-й степени, гемодинамически незначимый пролапс створок трикуспидального клапана, трикуспидальная недостаточность 1-й степени. МСКТ аорты: максимальный размер аорты на уровне синусов Вальсальвы — 55,8×58 мм, диаметр синусов Вальсальвы — 40,8 мм, в области перехода корня аорты в восходящий отдел — 45×45 мм, восходящий отдел диаметром 32—34 мм. Коронарография: поражений коронарного русла не выявлено. Дуплексное сканирование брахиоцефальных ветвей дуги аорты: патологические извитости (без значимого нарушения гемодинамики) обеих внутренних сонных артерий, обеих позвоночных артерий. Дуплексное сканирование артерий нижних конечностей: артерии обеих нижних конечностей проходимы, кровоток магистрального типа. Дуплексное сканирование вен нижних конечностей: вены обеих нижних конечностей проходимы, варикозная болезнь в бассейне большой подкожной вены с обеих сторон.

Общий анализ крови, биохимические анализ крови, коагулограмма, общий анализ мочи — без особенностей.

Диагноз на основании клинических данных

На основании данных анамнеза, осмотра и обследования, у пациента было диагностировано ННСТ. Учитывая сочетание у пациента расширения аорты и признаков системного вовлечения соединительной ткани (более 7 баллов), согласно Гентским критериям [1], наиболее вероятным представлялся диагноз СМ. Дифференциальный диагноз следовало проводить с синдромом Элерса-Данло. Пациент был направлен в РНЦХ, где ему была выполнена операция Дэвида (протез Вальсальвы Vascutek Gelweave 32 мм) с применением мини-J-стернотомии. Послеоперационный период проходил без осложнений.

Каскадный скрининг

Семейный анамнез был собран со слов пробанда и его родителей на приеме у врача-генетика (рис. 2). Признаки СМ были выявлены у пробанда (III,3) и его сына (IV,2). У родителей пробанда (II,4 и II,5) при осмотре врачом-генетиком больших и малых признаков синдрома отмечено не было. Генетический анализ был проведен всем членам семьи пробанда, включая сына и его родителей.

Рис. 2. Семейное древо пробанда (мужчина, 41 год).

Молекулярно-генетический анализ

Выделение ДНК проводили с помощью набора QIAampDNA Blood Mini Kit (Qiagen, Германия). Концентрацию ДНК определяли на флюориметре Qubit 4 (Thermo Fisher Scientific, США). Геномные библиотеки были приготовлены с помощью набора TruSeq DNA Exome (Illumina, США). Соникация ДНК была осуществлена на приборе Covaris S220 (Covaris, США). Далее было выполнено экзомное обогащение с использованием набора xGen hybridization capture of DNA libraries (IDT, США). Контроль качества был проведен с помощью Agilent 2100 Bioanalyzer (Agilent, США) и Qubit 4 (Thermo Fisher Scientific, США). Секвенирование выполнялось на секвенаторе нового поколения NextSeq550 (Illumina, США) с длиной прочтения 2×75 п.о. Все этапы эксперимента проводились согласно протоколам производителей.

Биоинформатический анализ

Парные чтения, полученные после секвенирования, были предоставлены для анализа в формате bcl, который был переведен в формат fastq. Оценка качества чтений была проведена с помощью программы FastQC, после чего были удалены с конца каждого чтения нуклеотиды, вероятность ошибки в которых была более 1 на 100, при помощи программы Trimmomatic. Прошедшие процедуру фильтрации пары чтений были картированы на геном человека версии hg19, в качестве картировщика была выбрана программа BWA-MEM. Удаление дублированных чтений осуществлено с помощью программы SAMtools. В результате для каждого пациента был получен BAM-файл, содержащий информацию об уникальных чтениях, картированных на референсный геном. Неточности выравнивания в областях вставок и делеций были устранены при помощи программы GATK, также с помощью GATK проводили поиск SNP в рамках целевых участков генома. В результате для каждого пациента были получены файлы, содержащие список вариантов нуклеотидной последовательности, их координаты, данные о покрытии и прочие характеристики. Найденные варианты нуклеотидной последовательности были проаннотированы с помощью программы ANNOVAR.

Определение патогенности и приоритезация вариантов нуклеотидной последовательности

В финальный анализ включались варианты, находящиеся в 32 генах, связанных с развитием наследственных синдромов ДСТ: ACTA2, ADAMTS10, COL1A1, COL2A1, COL3A1, COL4A5, COL5A1, COL5A2, DCHS1, EFEMP2, ELN, FBN1, FBN2, FLNA, GATA5, LOX, LTBP2, MAT2A, MFAP5, MYh21, MYLK, NOTCh2, PLOD1, PRKG1, SKI, SLC2A10, SMAD3, SMAD4, TGFB2, TGFB3, TGFBR1, TGFBR2 [2]. Все варианты проходили проверку на соответствие критериям патогенности согласно рекомендациям ACMG 2015 г. Отфильтрованные варианты перед включением в результаты генетического исследования были проанализированы врачом-генетиком и исследованы на предмет упоминания в новейших публикациях.

По данным генетического анализа был найден один новый, ранее не описанный патогенный вариант в гене FBN1(hg19::chr15:48757772_48757775del). Делеция 4 п.о. NM_000138:exon40:c.4932_4935delCACT приводит к сдвигу рамки считывания p.R1644fs.

В других исследуемых генах патогенных и вероятно-патогенных вариантов выявлено не было.

Номенклатура и классификация выявленного генетического варианта

Для описания выявленной мутации: (FBN1:NM_000138:exon40:c.4932_4935del:p.R1644fs.) использовались номенклатурные рекомендации Общества вариаций генома человека (HGVS) [5]. Выявленный вариант не был описан ни в одной из следующих баз данных (по состоянию на 30.09.19), описания мутации проверялись в следующих базах: MutationTaster, SIFT + Provean, OMIM.

Подтверждение найденных вариантов методом секвенирования по Сэнгеру

Были подобраны праймеры, фланкирующие участок с найденными полиморфизмами в нуклеотидных последовательностях: FBN1F_ATGAACAAGGGCCACCACTC и FBN1R_ACTTCAGACGGGCAGAGTAA (размер ПЦР-продукта — 900 пн). Постановку ПЦР осуществляли в 20 мкл смеси, где содержалось по 0,2 мМ каждого нуклеотида, 1х буфер для ПЦР, 20 нг ДНК-матрицы, 10 нг каждого праймера, 2,5 U ДНК-полимеразы. Амплификацию проводили на амплификаторе GeneAmp PCR System 9700 (Thermo Fisher Scientific, США) при следующих параметрах: 95 °С — 300 с; 30 циклов: 95 °C — 30 с, 62 °C — 30 с, 72 °C — 90 с; 72 °C — 600 с. Перед проведением реакции по Сэнгеру была выполнена очистка полученных ампликонов с использованием коммерческого реактива ExoSAP-IT (Affymetrix, США) по протоколу фирмы-производителя. Нуклеотидная последовательность продуктов ПЦР определялась с помощью набора реактивов ABI PRISM BigDye Terminator v. 3.1 с последующим анализом продуктов реакции на автоматическом секвенаторе ДНК Applied Biosystem 3500 DNA Analyzer (Thermo Fisher Scientific, США) (рис. 3).

Рис. 3. Электрофореграмма пробанда (III-3) и его родственников (IV-2, II-4, II-5) на FBN1:c.4932_4935delCACT (Референсная последовательность в GenBank: NM_000138).
F — сиквенс с прямого праймера; R — сиквенс с обратного праймера.

Результаты каскадного скрининга

После получения данных генетического анализа сын пробанда был дообследован педиатрами детской поликлиники. При обследовании по данным ЭхоКГ были выявлены аневризма аорты (диаметр на уровне синусов Вальсальвы — 21—22 мм, диаметр на уровне синотубулярного гребня — 16 мм), пролапс створок митрального клапана, пролапс створок трикуспидального клапана. Данные клинического обследования семьи представлены в табл. 1.

Таблица 1. Системное обследование и осмотр пробанда и его семьи

Учитывая клиническую картину и результаты генетической диагностики, пробанду и его сыну был установлен диагноз ННСТ — СМ.

Обсуждение

В результате обследования пациента с ДСТ и его родственников 1-й степени родства, в том числе с применением молекулярно-генетических методов, был установлен диагноз СМ пробанду и его сыну и выявлен новый, ранее не описанный патогенный вариант в гене FBN1 — делеция 4 п.о., приводящая к сдвигу рамки считывания и выраженным изменениям аминокислотной последовательности белка фибриллина-1. Диагноз сыну пробанда был установлен в раннем возрасте только благодаря проведению каскадного скрининга и генетического тестирования всех членов семьи.

СМ — это аутосомно-доминантное заболевание, вызванное мутацией в гене FBN1, кодирующего синтез гликопротеина фибриллина-1, при котором происходит нарушение строения соединительной ткани, затрагивающее сердечно-сосудистую систему, органы зрения и опорно-двигательный аппарат [1, 3]. Частота возникновения СМ составляет примерно 1 случай на 9800 общей популяции, причем в 26% случаев нет семейного анамнеза и заболевание возникает в результате мутации de novo [6]. Следует отметить, что СМ обладает выраженной клинической гетерогенностью ввиду различной пенетрантности и экспрессивности [1].

Особое внимание при ведении пациентов с СМ необходимо уделять состоянию сердечно-сосудистой системы, так как у них прежде всего имеется высокий риск ранней сердечной смерти, связанный с разрывом аневризмы крупных сосудов (чаще аорты). Следует отметить, что относительно недавно (около 30 лет назад) средняя продолжительность жизни при СМ составляла 32 года [1]. Основными осложнениями СМ являются прогрессирующая дилатация аорты и возникающая в результате этого недостаточность аортального клапана и расслаивающая аневризма аорты [6]; сердечная недостаточность по застойному типу, обусловленная нарушением сократимости сердечной мышцы и недостаточностью митрального клапана [7]; снижение зрения, вплоть до слепоты, которое объясняется слабостью ресничного пояска и подвывихом или вывихом хрусталика [8]. Из-за высокого риска осложнений таким пациентам необходимо дать индивидуальные рекомендации о графике посещений необходимых специалистов и мерах профилактики и лечения заболевания [1]. Специфического лечения СМ не существует, диагностика и лечение направлены на раннее выявление и профилактику осложнений заболевания. В табл. 2 представлена очередность проведения и перечень необходимых обследований для пациентов с СМ [9].

Таблица 2. Виды обследований и их регулярность у пациентов с СМ [9]

Примечание. * — периоды быстрого роста требуют более тщательного наблюдения; ** — если результаты обследования не соответствуют нормам, необходимо проводить дообследование. Рекомендуется наблюдение пациента в динамике.

Представляются важными ранняя постановка диагноза, в том числе с применением молекулярно-генетических тестов, и дальнейшее ведение пациентов на протяжении всей жизни неонатологом, педиатром и терапевтом. Кроме того, пациентам с СМ необходима своевременная помощь специалистов, таких как кардиолог, офтальмолог, ортопед, невролог, гастроэнтеролог, гематолог, эндокринолог, работающих единой командой [1].

Кардиологическое обследование включает в себя консультацию кардиолога, ЭхоКГ, ЭКГ, холтеровское мониторирование ЭКГ. ЭхоКГ необходимо делать минимум 1 раз в год. Посещение офтальмолога рекомендовано каждые 6 мес. Клиническое обследование сколиоза также предполагает визит к специалистам ежегодно каждые 6 мес. Каждые полгода необходимо посещать с ребенком таких специалистов, как ортопед и невролог [9].

Визиты к специалистам следует начинать с рождения ребенка, важно делать это регулярно, придерживаясь представленного графика. По достижении пациентом 18 лет он должен переходить к взрослым специалистам и продолжать регулярные обследования. Пациентам с СМ рекомендуется прием продуктов питания, обогащенных белками и витаминами (С, А, Е, РР, группы В — В1, В2, ВЗ, В6) [10]. Кроме того, им показан прием селективных β-адреноблокаторов в индивидуально подобранной дозировке под контролем пульса и уровня артериального давления [11]. При прогрессировании аневризмы сосудов рекомендовано оперативное лечение [1].

Пациентам с СМ противопоказано занятие тяжелой и легкой атлетикой, участие в спортивных соревнованиях, походы на длительные дистанции, психические перегрузки, растяжки, чрезмерное вытяжение позвоночника. Им не следует получать профессии, связанные с большими физическими и эмоциональными нагрузками. При склонности к спонтанному пневмотораксу необходимо избегать резких колебаний атмосферного давления, полетов на самолете, ныряния, частого использования метро, проживания в зонах жаркого климата и повышенной радиации [4]. Рекомендуется проведение медико-генетического консультирования перед вступлением в брак [4].

Раннее выявление СМ у сына пробанда, описанного в статье, позволит своевременно проводить профилактические мероприятия, направленные на предотвращение осложнений заболевания у ребенка.

Заключение

Таким образом, ввиду высокого риска осложнений и ранней смерти пациенты с СМ представляют собой серьезную проблему для здравоохранения и требуют индивидуального подхода в диагностике и лечении. Применение методов молекулярно-генетической диагностики позволяет поставить диагноз СМ максимально рано, до развития серьезных осложнений, и, соответственно, разработать план персонализированной профилактики и лечения, с целью увеличения продолжительности жизни.

Участие авторов:

Концепция и дизайн исследования — А.М., А.Е., О.Д.

Сбор и обработка материала — Е.К., А.К., А.Ж., М.Д., О.С., И.Е., М.П.

Написание текста — А.М., Е.К., А.К., А.Е.

Редактирование — А.М., А.К., А.Е.

Авторы заявляют об отсутствии конфликта интересов.

Дисплазия соединительной ткани у детей: симптомы и лечение

Дисплазия соединительной ткани у детей — заболевание, характеризующееся наследственным нарушением в структуре коллагена или фибриллина. Эти белки обеспечивают целостность соединительнотканных структур в организме человека. Заболевание характеризуется различными симптомами и проявляется нарушениями работы дыхательной, пищеварительной, опорно-двигательной и других систем. В терапии используется комплексный подход, позволяющий предупредить прогрессирование патологии и развитие инвалидности у ребенка.

Причины возникновения

Дисплазия соединительной ткани у детей: проявления и подходы к лечению

Выделить одну причину развития дисплазии соединительной ткани у детей невозможно. Существуют различные факторы, способные привести к возникновению патологии. В зависимости от связи с наследственностью выделяют две формы дисплазии:

  • недифференцированная, характеризующаяся выраженными клиническими проявлениями, но не имеющая наследственного характера;
  • дифференцированная — связанная с генетическими изменениями.

Все факторы риска развития болезни делят на врожденные и приобретенные. К врожденным относят генетические мутации в генах, кодирующих белки соединительной ткани, например, коллагена или фибриллина. Приобретенные факторы представлены следующими состояниями: вредные привычки у матери во время беременности, нерациональное питание, негативные экологические условия и др.

Классификация заболевания

Для оценки прогноза и характера течения патологии врачи определяют тип дисплазии — дифференцированный или недифференцированный. Первая форма заболевания имеет установленную наследственную причину, например, синдром Марфана, Альпорта и др. Для диагностики дифференцированного варианта проводят генетические исследования у ребенка и родителей.

Недифференцированная дисплазия встречается чаще. Однозначно определить причину при этом не удается. Системные нарушения в структуре соединительной ткани приводят к различным клиническим проявлениям с поражением различных систем и органов. Для постановки подобного диагноза врач должен исключить наследственные синдромы.

Клинические проявления

Недифференцированная форма болезни не связана с наследственностью

 

Симптомы дисплазии в детском возрасте принято разделять на две группы: висцеральные и фенотипические. Они выявляются во время обследования у лечащего врача. Фенотипические признаки видны при внешнем осмотре. К ним относят:

  • удлинение пальцев, стоп и кистей;
  • различные варианты деформации грудной клетки;
  • повышенная подвижность суставов. Например, ребенок может переразгибать локти или колени;
  • появление варикозной болезни в подростковом возрасте;
  • ранняя близорукость;
  • ассиметричное лицо с нарушениями прикуса;
  • искривления позвоночника различной степени тяжести;
  • Х- и О-образная деформация голеней;
  • множественные пигментные пятна и сосудистые сеточки на коже.

Указанные симптомы выявляются у большинства больных с дисплазией соединительной ткани. Они имеют разную степень выраженности.

 

В диагностике заболевания участвует не только педиатр, но и другие специалисты: кардиолог, пульмонолог, невролог и пр. Это зависит от клинической картины болезни.

 

Висцеральные проявления характеризуются изменениями работы внутренних органов и нервной системы на фоне дисплазии. Эти признаки не имеют внешних проявлений, поэтому специалисту необходимо тщательно собирать жалобы ребенка и его родителей. Основные висцеральные симптомы:

  • плохой сон и повышенная сонливость в течение дня;
  • частые головные боли, не имеющие конкретной локализации;
  • гипервозбудимость;
  • тревожность;
  • нарушения работы органов желудочно-кишечного тракта в виде метеоризма, запоров и др.;
  • изменение уровня артериального давления;
  • признаки поражения мочевыделительной системы: ночное недержание мочи и т.п.

При выявлении указанных симптомов родителям необходимо сразу обратиться за медицинской помощью. Специалист подберет необходимое обследование и сможет поставить точный диагноз.

Диагностические мероприятия

 

Дисплазия соединительной ткани у детей выявляется при комплексном обследовании. Оно начинается с изучения имеющихся жалоб у ребенка и его родителей. После этого проводится внешний осмотр с оценкой степени подвижности суставов по шкале Бейтона. Врач проводит измерение длины стоп, рук и ног, а также замеры охвата головы и груди.

Проводятся дополнительные лабораторные и инструментальные методы. Для выявления заболеваний сердечно-сосудистой системы показано выполнение электрокардиографии, ЭхоКГ и УЗИ магистральных сосудов. Для оценки состояния тазобедренных суставов и других частей опорно-двигательного аппарата проводят рентгенографию или компьютерную томографию. При симптомах поражения внутренних органов назначают их дополнительное обследование.

Лечение заболевания

 

Терапия, позволяющая полностью избавиться от дисплазии соединительной ткани, не разработана. В основе патологии лежит врожденный или приобретенный генетический дефект, который невозможно исправить. Поэтому лечение направлено на предупреждение развития осложнений болезни и повышение качества жизни пациента.

В качестве лечебных мероприятий используют лекарственные препараты, физкультуру и изменения рациона питания. Терапия подбирается и проводится только под наблюдением лечащего врача.

Cимптомы заболевания различны в зависимости от формы патологии

 

В лечении применяют различные группы медикаментозных препаратов, улучшающих состояние внутренних органов и нервной системы. Основные используемые классы лекарственных средств:

  • витаминные комплексы с добавлением магния. Обеспечивают нормализацию обмена веществ в организме и улучшают работу скелетной мускулатуры и сердца;
  • ноотропы — группа лекарственных средств, улучшающих состояние нервной ткани. Современные препараты могут использоваться в раннем возрасте;
  • препараты, улучшающие обменные процессы в миокарде. Позволяют предупредить развитие миокардита и его осложнений;
  • антибактериальные препараты используются при выявлении у ребенка сопутствующей бактериальной инфекции, например, бронхита или пневмонии;
  • успокоительные медикаменты на растительной основе;
  • лекарственные комплексы, содержащие коллаген и его предшественники, а также витамин С.

При выборе медикаментозного лечения следует учитывать имеющиеся у ребенка нарушения работы внутренних органов. Все препараты имеют определенные показания и противопоказания к назначению. Их несоблюдение может стать причиной прогрессирования расстройств или развития побочных эффектов.

Изменение рациона питания

 

Клинические рекомендации по терапии дисплазии в детском возрасте указывают, что ребенок с заболеванием нуждается в специальной диете. Она основана на повышении потребления продуктов, содержащих коллаген, или веществ, стимулирующих его образование в организме.

К коллагенсодержащим продуктам относят все виды нежирного мяса, морскую рыбу и водоросли. Стимулируют образование белка соединительной ткани продукты, богатые витамином С. Например, ягоды, соя, печень животных и птиц, бананы и пр.

 

Диета — важная часть терапии заболевания. Родителям необходимо проконсультироваться по ее поводу с педиатром и диетологом.

 

Также из рациона питания устраняют фастфуд, жирную, соленую и острую пищу. Употребление кондитерских и хлебобулочных изделий ограничено.

Хирургические вмешательства

 

Инвалидность детей с дисплазией связана с изменениями в опорно-двигательном аппарате и сердечно-сосудистой системе. Заболевание приводит к патологиям артерий и вен, деформации позвоночника, грудной клетки и другим негативным изменениям в организме. Для их коррекции врачи проводят оперативные вмешательства, направленные на устранение дефектов. Ребенок при этом нуждается в госпитализации в профильную больницу. Операции проводят после обследования пациента и определения показаний к ним.

 

Системная дисплазия соединительной ткани в детском возрасте характеризуется множественными клиническими проявлениями — от изменения длины пальцев до тяжелых пороков сердечно-сосудистой системы. Прогноз при своевременном выявлении заболевания благоприятный.

Врачи обеспечивают комплексное лечение, которое тормозит развитие патологических процессов в организме и позволяет предупредить развитие осложнений. Если родители долгое время занимаются самолечением и не обращаются за медицинской помощью, то заболевание может стать причиной гибели ребенка или его инвалидности.

Видео

Читайте в следующей статье: акклиматизация у детей

Морфологические признаки дисплазии соединительной ткани как предикторы частых посттренировочных нарушений опорно-двигательного аппарата | BMC Musculoskeletal Disorders

  • 1.

    Wojtys EM. Профилактика спортивных травм. Спортивное здоровье. 2019; 11 (1): 16–7.

    PubMed Статья Google ученый

  • 2.

    Коган Э.А., Николенко В.Н., Занозин А.С., Демура Т.А., Колосовский Д.Ю. Синдром недифференцированной дисплазии соединительной ткани в сочетании с наследственной тромбофилией как причина первичного женского бесплодия, Мед. Журнал Северного Кавказа.2016; 11 (2–2): 323–6.

  • 3.

    Стязкина С.Н., Князев А.Д., Минаханов И.И. Дисплазия соединительной ткани в современной клинической практике. Современные инновации. 2016; 5 (7): 57–64.

    Google ученый

  • 4.

    Моска М., Тани С., Ваньяни С., Бомбардиери С. Диагностика и классификация недифференцированных заболеваний соединительной ткани. J Autoimmun. 2014; 48-49: 50–2.

    PubMed Статья Google ученый

  • 5.

    Capuano A, Bucciotti F, Farwell KD, Tippin Davis B, Mroske C, Hulick PJ, Weissman SM, Gao Q, Spessotto P, Colombatti A, Doliana R. Диагностическое секвенирование экзома идентифицирует новый ген EMILIN1, связанный с аутосомно-доминантным наследственное заболевание соединительной ткани. Hum Mutat. 2016; 37 (1): 84–97.

    CAS PubMed Статья Google ученый

  • 6.

    Alazami AM, Al-Qattan SM, Faqeih E, Alhashem A, Alshammari M, Alzahrani F, Al-Dosari MS, Patel N, Alsagheir A, Binabbas B, Alzaidan H, Alsiddiky A, Aladhelbi N, Alsiddiky A. М., Кентаб А., Даза Р. М., Кирчер М., Шендуре Дж., Хашем М., Альшахрани С., Рахбини З., Халифа О, Шахин Р., Алькурая Ф. С.Расширение клинико-генетической гетерогенности наследственных нарушений соединительной ткани. Hum Genet. 2016 Май; 135 (5): 525–40.

    CAS PubMed Статья Google ученый

  • 7.

    Бен С.М., Репин Н.Б. Клинический диагноз недифференцированной дисплазии соединительной ткани. Русс Мед Биол Журнал 2016; 24 (4): 164–72. Академик И.П. Павлова.

    Google ученый

  • 8.

    Сунг Ю.К., Чунг Л.Легочная артериальная гипертензия, связанная с заболеванием соединительной ткани. Rheum Dis Clin N Am. 2015. 41 (2): 295–313.

    Артикул Google ученый

  • 9.

    Arroyo-Avila M, Vila LM. Тампонада сердца у больного смешанным заболеванием соединительной ткани. J Clin Rheumatol. 2015; 1 (21): 42–5.

    Артикул Google ученый

  • 10.

    Кадурина Т.И., Гнусаев С.Ф., Аббакумова Л.Н., Алимова И.Л., Антонова Н.С., Апенченко Ю.С., Арсентьев В.Г., Дакуко А.Н., Копцева А.В., Краснова Е.Е., Кудинова Е.Г., Иванова И.И., Иванова И.Л., Лисицына Л.В. С.В., Мамбетова А.М., Мурга В.В., Николаева Е.А., Плотникова О.В., Сертакова А.В.Наследственные и многофакторные нарушения соединительной ткани у детей. Алгоритмы диагностики. Тактика обращения к проекту российских рекомендаций была разработана экспертной комиссией педиатрической группы «Дисплазия соединительной ткани» при Российском научном сообществе врачей. Med Bull Северный Кавказ. 2015; 10 (1): 5–35.

    Google ученый

  • 11.

    Мартынов А.И., Нечаева Г.И., Акатова Е.В., Вершинина М.В., Викторова И.А., Гольцова Л.Г., Громова О.А., Делов Р.А., Дрокина О.В., Друк И.В., Дубилей Г.С., Иванова Д.С., Иванова И.Л., Калинина И.Ю., Кононова Н.Ю. , Кудинова Е.Г., Лалов Ю.В., Лисиченко О.В., Логинова Е.Н., Лялукова Ю.А. и др.Клинические рекомендации Российского научного медицинского общества терапевтов по диагностике, лечению и реабилитации пациентов с дисплазией соединительной ткани (первая редакция). Med Bull Северный Кавказ. 2018; 13 (1–2): 137–209.

  • 12.

    Castori M, Castori M, Tinkle B, Levy H, et al. Основа для классификации гипермобильности суставов и связанных состояний. Am J Med Genet C Semin Med Genet. 2017; 175С: 148–57.

    Артикул Google ученый

  • 13.

    Haller G, Haller G, Zabriskie H, Spehar S, et al. Отсутствие гипермобильности суставов увеличивает риск хирургического вмешательства при идиопатическом сколиозе у подростков. Журнал Педиатр Ортоп Б. 2018; 27 (2): 152–8.

    PubMed PubMed Central Статья Google ученый

  • 14.

    Scheper MC, de Vries JE, Verbunt J, Engelbert RH. Хроническая боль при синдроме гипермобильности и синдроме Элерса-Данлоса (тип гипермобильности): это проблема. J Pain Res. 2015; 8: 591–601.https://doi.org/10.2147/JPR.S64251. eCollection 2015. Обзор.

    PubMed PubMed Central Статья Google ученый

  • 15.

    Дангин А., Тарди Н., Веттштейн М., Мэй О., Бонин Н. Микроинстабильность бедра: обзор. Orthop Traumatol Surg Res. 2016; 102 (8S): S301–9. https://doi.org/10.1016/j.otsr.2016.09.002. Epub 2016 12 октября. Обзор.

    CAS PubMed Статья Google ученый

  • 16.

    Акимова А.В., Миронов В.А., Гагиев В.В., Тарасова Е.В., Палабугина П.А., Хусаинова Д.Ф., Таланкина А.А. Особенности клиники и вегетативной регуляции синусового ритма сердца у лиц с недифференцированной дисплазией соединительной ткани. Bull Ural Med Acad Sci. 2017; 14 (4): 315–24.

    Google ученый

  • 17.

    Арсени Л., Ломбарди А., Ориоли Д. От структуры к фенотипу: влияние изменений коллагена на здоровье человека. Int J Mol Sci.2018; 19 (5). https://doi.org/10.3390/ijms1

  • 07. Рассмотрение.

  • 18.

    Мартынов А.И., Нечаева Г.И., Акатова Е.В., Вершинина М.В., Викторова И.А., Громова О.А., Дрокина О.В., Друк И.В., Дубилей Г.С., Ильиных А.А., Кудинова Е.Г., Лисиченко О.В., Логинова Е.Н., Лялюкова Т.А., Нагаева , Надей Е.В., Плотникова О.В., Пономарева Д.А., Семенкин А.А., Ю.Т. и др. Национальные рекомендации Российского научного медицинского общества терапевтов по диагностике, лечению и реабилитации пациентов с дисплазией соединительной ткани.Med J Северный Кавказ. 2016; 11 (1): 2–76.

    Google ученый

  • 19.

    Castori M, Morlino S, Ghibellini G, Celletti C, Camerota F, Grammatico P. Соединительная ткань, синдром (ы) Элерса-Данлоса, головная и шейная боль. Am J Med Genet C: Semin Med Genet. 2015. 169 (1): 84–96.

    Артикул Google ученый

  • 20.

    Акимова А.В., Тарасова Е.В., Черникова Л.Г. Клинико-фенотипические особенности молодых людей с недифференцированной дисплазией соединительной ткани.Med J MIA. 2018; 1 (92): 63–7.

    Google ученый

  • 21.

    Кадурина Т.И., Аббакумова Л.Н. Оценка степени выраженности недифференцированной дисплазии соединительной ткани у детей. Med Bull Северный Кавказ. 2008; 2: 15–20.

    Google ученый

  • 22.

    Аббакумова Л.Н., Арсентьев В.Г., Гнусаев С.Ф., Иванова И.И., Кадурина Т.И., Трисветова Е.Л., Чемоданов В.В., Чухловина М.Л. Наследственные и многофакторные нарушения соединительной ткани у детей.Диагностические алгоритмы. Тактика обращения. Российские рекомендации. Педиатр. 2016; 7 (2): 5–39.

    Google ученый

  • 23.

    Земцовский Э.В., Тимофеев Э.В., Малев Э.Г. Наследственные нарушения (дисплазия) соединительной ткани. Какое из двух действующих национальных руководств предпочтительнее? Педиатр. 2017; 8 (4): 6–18.

    Google ученый

  • 24.

    Марухно Ю.И., Пантковский А.С.Дисплазия соединительной ткани у спортсменов. Med Prospects. 2012; 17 (1): 114–8.

    Google ученый

  • 25.

    Чемоданов В.В., Краснова Е.Е., Горнаков И.С. Конституциональная типология, наследственная предрасположенность и дисплазия соединительной ткани у детей: история изучения. Бык Ивановская Медакад. 2013. 18 (2): 62–5.

    Google ученый

  • 26.

    Нишимура Р.А., Отто С.М., Боноу Р.О., Карабелло Б.А., Эрвин Дж. П. 3-й, Флейшер Л.А., Джнейд Х., Мак М.Дж., МакЛеод С.Дж., О’Гара П.Т., Риголин В.Х., Сундт Т.М. 3-й, Томпсон А.Актуализированное AHA / ACC обновление Руководства AHA / ACC по ведению пациентов с клапанной болезнью сердца 2014 года: отчет целевой группы Американского колледжа кардиологов / Американской кардиологической ассоциации по руководствам по клинической практике. Тираж. 2017; 135 (25): e1159–95. https://doi.org/10.1161/CIR.0000000000000503. Epub 2017 15 марта. Обзор.

    PubMed Статья Google ученый

  • 27.

    Нечаева Г.И., Викторова И.А. Дисплазия соединительной ткани: терминология, диагностика, тактика ведения больных, т.188. Омск: ООО «Типография Бланк»; 2007.

    Google ученый

  • 28.

    Кир Р., Симмондс Дж. Совместная защита и физическая реабилитация взрослых с синдромом гипермобильности. Curr Opin Rheumatol. 2011. 23 (2): 131–6. https://doi.org/10.1097/BOR.0b013e328342d3af. Рассмотрение.

    PubMed Статья Google ученый

  • 29.

    Кумар Б., Ленерт П. Синдром гипермобильности суставов: определение причины хронической боли, которую обычно не замечают.Am J Med. 2017; 130 (6): 640–7. https://doi.org/10.1016/j.amjmed.2017.02.013. Epub 2017 10 марта. Обзор.

    PubMed Статья Google ученый

  • 30.

    Шодикулова Г.З. Особенности клинико-функциональных нарушений у больных с недифференцированной дисплазией соединительной ткани. Eur Sci Rev.2017; 17 (3–4): 72–4.

    Артикул Google ученый

  • 31.

    Палмер С., Бейли С., Баркер Л., Барни Л., Эллиотт А.Эффективность лечебных упражнений при синдроме гипермобильности суставов: систематический обзор. Физиотерапия. 2014; 100 (3): 220–7. https://doi.org/10.1016/j.physio.2013.09.002. Epub 2013 5 октября. Обзор.

    PubMed Статья Google ученый

  • 32.

    Toprak Celenay S, Ozer KD. Эффекты упражнений по стабилизации позвоночника у женщин с синдромом доброкачественной гипермобильности суставов: рандомизированное контролируемое исследование. Rheumatol Int. 2017; 37 (9): 1461–8.https://doi.org/10.1007/s00296-017-3713-6. Epub 2017 30 марта.

    PubMed Статья Google ученый

  • 33.

    Кунабай К, Сайданова АБ, Суйналиева АА. Психовегетативные, астенические и когнитивные нарушения при дисплазии соединительной ткани: выбор оптимальной терапии. Вестник КазНМУ. 2017; 1 (2): 255–60.

  • 34.

    Бергельсон Т., Машин В., Белова Л., Прошин А., Белова Н., Абдулаев И. Неврологические и психологические особенности детей с дисплазией соединительной ткани.Clin Neurosci. 2017; 1 (Михайловский собор): 16–8.

    Google ученый

  • 35.

    Тимофеев Е.В., Зарипов Б.И., Белоусова Т.И., Вутрих Е.В., Реева С.В., Парфенова Н.Н., Земцовский Е.В. Фенотипическая характеристика юношей и девушек в зависимости от типа телосложения и низкой массы тела. Врач педиатр (Санкт-Петербург). 2020; 11 (1): 27–35.

    Артикул Google ученый

  • 36.

    Mukerji B, Hardin JG.Недифференцированные, перекрывающиеся и смешанные заболевания соединительной ткани. Am J Med Sci. 1993. 305 (2): 114–9.

    CAS PubMed Статья Google ученый

  • 37.

    Cavagna L, Codullo V, Ghio S, Scirè CA, Guzzafame E, Scelsi L, Caporali R. Недиагностированные заболевания соединительной ткани: высокая распространенность у пациентов с легочной артериальной гипертензией. Медицина. 2016; 95 (39).

  • 38.

    Касама Т., Маэока А., Огуро Н. Клинические особенности психоневрологических синдромов при системной красной волчанке и других заболеваниях соединительной ткани.Clin Med Insights. 2016; 9 CMAMD-S37477.

  • 39.

    Kim ST, Brinjikji W, Kallmes DF. Распространенность внутричерепных аневризм у пациентов с заболеваниями соединительной ткани: ретроспективное исследование. Am J Neuroradiol. 2016; 37 (8): 1422–6.

    CAS PubMed Статья Google ученый

  • 40.

    Lecouffe-Desprets M, Groh M, Bour B, Le Jeunne C, Puechal X. Эозинофильные желудочно-кишечные расстройства, связанные с аутоиммунным заболеванием соединительной ткани.Костный сустав позвоночника. 2016; 83 (5): 479–84.

    CAS PubMed Статья Google ученый

  • 41.

    Li M, Luo W, Li P, Luo J, Huo J, Li Y. Желудочно-кишечный васкулит, вызванный заболеванием соединительной ткани: клинический анализ 14 случаев. Int J Clin Exp Pathol. 2016; 9 (2): 2091–8.

    CAS Google ученый

  • 42.

    Фикри А., Челимский Г., Коллинз Х., Ковачич К., Азиз К.Поражение желудочно-кишечного тракта при синдромах Элерса-Данлоса. Am J Med Genet Часть C. 2017; 175 (1): 181–7.

    PubMed Статья Google ученый

  • 43.

    Arora M, Bagi P, Strongin A, Heimall J, Zhao X, Lawrence MG, Kleiner DE. Желудочно-кишечные проявления синдрома дефицита STAT3 гипер-IgE. J Clin Immunol. 2017; 37 (7): 695–700.

    CAS PubMed Статья Google ученый

  • 44.

    Шимода С, Чонг Й, Акахоши М., Нииро Х., Цукамото Х. Печеночные и желудочно-кишечные проявления при ревматических заболеваниях и заболеваниях соединительной ткани. J Gen Fam Med. 2016; 17 (2): 132–7.

    Артикул Google ученый

  • 45.

    Слаттенгрен А.Х., Ниссли Т., Бластин Дж., Бадер А., Вестфолл Е. Наилучшие варианты использования остеопатических манипуляций. J Fam Pract. 2017; 66 (12): 743–7 Обзор.

    PubMed Google ученый

  • 46.

    Рекомендации Американской остеопатической ассоциации по остеопатическому манипулятивному лечению (OMT) для пациентов с болью в пояснице. Целевая группа по клиническим практическим рекомендациям по боли в пояснице. J Am Osteopath Assoc. 2016; 116 (8): 536–49. https://doi.org/10.7556/jaoa.2016.107.

    Артикул Google ученый

  • Дисплазия соединительной ткани | Сеть детских больниц Сиднея

    Заявление об ограничении ответственности: этот информационный бюллетень предназначен только для образовательных целей.Проконсультируйтесь со своим врачом или другим медицинским работником, чтобы убедиться, что эта информация подходит вашему ребенку.

    Название «дисплазия соединительной ткани» охватывает широкий спектр заболеваний. Эти нарушения вызваны слабостью соединительных тканей, таких как кости, связки, сухожилия и кожа.

    У детей с этими заболеваниями могут быть:

    • Слишком сильное движение суставов (гипермобильность)
    • Недостаточное движение суставов (контрактуры суставов)
    • Хрупкие кости, кожа, кровеносные сосуды или связки
    • дегенеративное заболевание суставов
    • низкий рост
    • Спинальные осложнения

    Расстройства могут быть разными, потому что многие люди имеют сочетание этих различных симптомов.

    Большинство дисплазий соединительной ткани наследуются по общим образцам. Эти шаблоны могут помочь генетическим консультантам предоставить семьям информацию о наследственности в их семье.

    Виды расстройств

    Расстройства можно сгруппировать в:

    • Синдромы Элерса-Данлоса (СЭД)
    • Синдром Марфана и родственные расстройства
    • Дисплазии скелета
    • Расстройства ломкости костей Синдром Элерса-Данлоса

      Более тяжелые формы синдромов Элерса-Данлоса (СЭД) имеют некоторую степень хрупкости тканей с рождения и на протяжении всей жизни.У некоторых людей может быть хрупкая кожа (классический тип), в то время как у других хрупкие кровеносные сосуды со склонностью к синякам или разрывам кровеносных сосудов (сосудистый тип). В редких случаях роговицы глаз бывают хрупкими, что может привести к потере зрения.

      Цели управления включают предотвращение травм кожи, кровеносных сосудов и глаз, защиту ослабленных суставов и лечение конкретных осложнений.

      Синдром гипермобильности суставов, также известный как синдром Элерса-Данлоса гипермобильного типа, представляет собой комбинацию широко распространенной гипермобильности суставов (двойного сустава) и хронических заболеваний опорно-двигательного аппарата.См. Отдельный информационный бюллетень «Гипермобильность суставов».

      Синдром Марфана может быть связан с высоким ростом и длинными руками и ногами. Существует повышенный риск нарушения зрения в детстве из-за вывиха хрусталика глаза. Также может возникнуть аневризма главного кровеносного сосуда (аневризма аорты), но серьезных осложнений можно избежать с помощью регулярных медицинских осмотров и осмотров сердца.

      Скелетная дисплазия

      В этой группе около 400 заболеваний.Они влияют на кости (дисплазии костей) и / или хрящи (хондродисплазии).

      Чаще всего приводят к низкому росту и обычно нормальному интеллекту. Там, где присутствует низкий рост, существуют разные модели: у некоторых людей нормальный рост верхней части тела и короткие конечности, а у других — короткое туловище. Некоторые дисплазии скелета связаны с проблемами с внутренними органами и потерей зрения и слуха. У каждого расстройства или группы расстройств есть особые требования к ведению.

      Накопление сложных сахаров в организме может вызвать проблемы с ростом и функцией скелета и соединительной ткани, как это наблюдается при мукополисахаридозах (МПС).

      В зависимости от типа МПС может быть ряд проявлений.

      Болезни хрупких костей

      Люди с хрупкими костями имеют хрупкие кости, которые легко ломаются. Существуют разные типы заболеваний хрупких костей, диапазон и степень тяжести варьируются от человека к человеку.

      Несовершенный остеогенез (OI)

      Несовершенный остеогенез (OI) является наиболее распространенным типом заболевания хрупких костей. У некоторых людей с НО белки глаз, известные как склеры, выглядят синими.Люди с тяжелыми формами НО могут иметь низкий рост, а у некоторых развиваются деформации конечностей и / или позвоночника. Зубы также могут быть хрупкими. Детям с заболеваниями хрупких костей требуется специализированная мультидисциплинарная оценка и лечение.

      Помните:

      Если у вас есть опасения по поводу вашего ребенка, пожалуйста, обсудите их со своим терапевтом или педиатром, в большинстве государственных больниц в Новом Южном Уэльсе есть генетическая клиника, где можно получить консультацию по диагнозу.

      Публикации, рекомендованные экспертами наших больниц, можно найти в книжном магазине Kids Health.

      Смешанное заболевание соединительной ткани — симптомы и причины

      Обзор

      Смешанное заболевание соединительной ткани (MCTD) имеет признаки и симптомы сочетания заболеваний, в первую очередь волчанки, склеродермии и полимиозита. Многие люди с этим необычным заболеванием также страдают синдромом Шегрена. По этой причине MCTD иногда называют болезнью перекрытия.

      При смешанном заболевании соединительной ткани симптомы отдельных заболеваний обычно проявляются не сразу.Вместо этого они, как правило, возникают в течение нескольких лет, что может затруднить диагностику.

      Ранние признаки и симптомы часто связаны с руками. Пальцы могут опухать, а кончики пальцев становиться белыми и немеющими, часто в результате воздействия холода. На более поздних стадиях могут быть поражены некоторые органы, такие как легкие, сердце и почки.

      Нет лекарства от смешанного заболевания соединительной ткани. Лечение зависит от тяжести заболевания и пораженных органов.

      Продукты и услуги

      Показать больше товаров от Mayo Clinic

      Симптомы

      Ранние признаки смешанного заболевания соединительной ткани могут включать:

      • Общее недомогание. Это может включать повышенную утомляемость и легкий жар.
      • Холодные и онемевшие пальцы рук или ног (феномен Рейно). В ответ на холод или стресс пальцы рук и ног могут стать белыми, а затем багрово-синими. После согревания краснеют пальцы рук или ног.
      • Опухшие пальцы или руки. У некоторых людей отеки пальцев.
      • Боль в мышцах и суставах. Суставы могут воспаляться, опухать и деформироваться, как при ревматоидном артрите.
      • Сыпь. Красные или красновато-коричневые пятна могут появляться на костяшках пальцев.

      Когда обращаться к врачу

      Обратитесь к врачу, если у вас есть признаки и симптомы, мешающие повседневной жизни, особенно если вам поставили диагноз волчанка или другое заболевание соединительной ткани.

      Причины

      Смешанное заболевание соединительной ткани — это аутоиммунное заболевание, причина которого неизвестна.При аутоиммунных заболеваниях ваша иммунная система, отвечающая за борьбу с болезнями, по ошибке атакует здоровые клетки.

      При заболеваниях соединительной ткани ваша иммунная система атакует волокна, которые обеспечивают основу и поддержку вашего тела. Некоторые люди со смешанным заболеванием соединительной ткани имеют семейный анамнез этого заболевания. Но роль генетики в заболевании остается неясной.

      Факторы риска

      Смешанное заболевание соединительной ткани может возникнуть у людей любого возраста.Однако чаще всего это встречается у женщин в возрасте до 50 лет.

      Осложнения

      Смешанное заболевание соединительной ткани может привести к серьезным осложнениям, некоторые из которых могут быть фатальными. Осложнения включают:

      • Повышенное артериальное давление в легких (легочная гипертензия). Это состояние является основной причиной смерти людей со смешанным заболеванием соединительной ткани.
      • Интерстициальная болезнь легких. Эта большая группа заболеваний может вызывать рубцы в легких, что влияет на вашу способность дышать.
      • Болезнь сердца. Части сердца могут увеличиваться или вокруг сердца может возникать воспаление. Возможна сердечная недостаточность.
      • Поражение почек. Примерно у четверти людей со смешанным заболеванием соединительной ткани возникают проблемы с почками. Поражение почек обычно бывает легким, но может привести к почечной недостаточности.
      • Повреждение пищеварительного тракта. Обычно смешанное заболевание соединительной ткани поражает пищеварительный тракт. У вас могут возникнуть боли в животе и проблемы с глотанием и перевариванием пищи.
      • Анемия. Около 75% людей со смешанным заболеванием соединительной ткани страдают железодефицитной анемией.
      • Смерть ткани. У людей с тяжелой формой болезни Рейно может развиться гангрена пальцев.
      • Потеря слуха. В одном небольшом исследовании потеря слуха была зарегистрирована почти у половины пациентов со смешанным заболеванием соединительной ткани. Чтобы понять эту связь, необходимы дополнительные исследования.
      • Повреждение нерва. Синдром Шегрена может повлиять на нерв, который передает ощущение от вашего лица к мозгу (тройничный нерв).Если у вас невралгия тройничного нерва, даже легкая стимуляция лица — например, чистка зубов или нанесение макияжа — может вызвать приступ сильной боли.

      Недифференцированное заболевание соединительной ткани — углубленный обзор

      Что такое недифференцированное заболевание соединительной ткани?

      Термин «недифференцированное заболевание соединительной ткани» (НДСТ) используется для описания состояния у людей, у которых есть симптомы и результаты лабораторных анализов, указывающие на системное аутоиммунное заболевание или заболевание соединительной ткани, но не соответствующие таким характеристикам, чтобы указывать на диагноз. для четко определенного заболевания соединительной ткани, такого как ревматоидный артрит, системная красная волчанка (волчанка) или склеродермия.Таким образом, похоже, что у них есть другое похожее заболевание, которое врачи называют недифференцированным заболеванием соединительной ткани.

      Хотя слово «недифференцированный» звучит расплывчато, оно описывает реальную проблему. Это не означает, что врач не знает, как назвать это состояние, это просто означает, что все или большинство клинических признаков (проблем), традиционно наблюдаемых при волчанке или другом заболевании соединительной ткани, отсутствуют, но некоторые из этих признаков присутствуют. .

      Эта недифференцированная категория четко отделена от другой группы расстройств, имеющих нечеткое звучание, называемых синдромами перекрытия.Люди с совпадающими синдромами имеют четкие черты по крайней мере двух или более CTD, и, таким образом, могут соответствовать диагнозам нескольких одновременно. (Ревматологи и ученые не все согласны с точным определением «синдрома перекрытия». В целом, этот термин относится к состоянию, при котором у пациента наблюдаются симптомы двух или более признанных аутоиммунных заболеваний.)

      Напротив, у пациентов с НДСТ недостаточно признаков определенного ДСТ (системная волчанка, системный склероз или дерматомиозит / полимиозит), чтобы их можно было твердо классифицировать с таким диагнозом.Однако, поскольку они могут иметь некоторые признаки нескольких известных заболеваний, их называют «недифференцированными». (См. Рис.1)

      Рисунок 1

      Термин «недифференцированное заболевание соединительной ткани» впервые был использован в 1980-х годах для идентификации людей, которые были признаны находящимися на ранних стадиях CTD, но которые еще не соответствовали стандартным критериям для четко определенного CTD. В то время было отмечено, что значительная часть этих пациентов либо оставалась недифференцированной, либо пережила ремиссию заболевания и никогда не перешла в более выраженное ревматическое заболевание.Другие названия, использовавшиеся на раннем этапе для описания некоторых из этих пациентов, включали «скрытую волчанку» и «неполную красную волчанку», что означало, что присутствовали некоторые признаки, указывающие на волчанку, но недостаточно для подтверждения диагноза. Четверть всех пациентов, наблюдаемых ревматологами, имеют НДСТ.

      Многие исследователи изучали людей с НДСТ, чтобы определить серологические профили (маркеры в крови), которые могут предсказать, у кого в конечном итоге разовьется четко определенное заболевание соединительной ткани.Они также ищут маркеры, которые помогут предсказать, исчезнет ли болезнь, останется неизменной или ухудшится. В настоящее время считается, что менее чем у 20% пациентов с НДСТ развивается определенное заболевание соединительной ткани. Почти каждый третий испытает ремиссию своих симптомов. Остальные продолжают протекать в недифференцированной форме в целом легкой степени тяжести.

      Патогенез

      Патогенез относится к возникновению и развитию болезни. Истинная причина НДСТ, как и многих ревматических заболеваний, до конца не изучена.Действительно, не было никаких серьезных попыток дать определение фундаментальной науки UCTD. Предполагается, что могут быть задействованы многие из тех же иммунологических механизмов, которые играют роль при волчанке и ревматоидном артрите. Одна из теорий состоит в том, что у некоторых людей есть генетическая предрасположенность, которая впоследствии вызывается фактором окружающей среды, например инфекцией, на которую затем неправильно реагирует иммунная система. Это, в свою очередь, заставляет иммунную систему неправильно реагировать и нацеливаться на ткани человека, а не на чужеродных захватчиков (таких как вредные бактерии).Остается неизвестным, какой именно из этих элементов может участвовать в НДСТ. НДСТ очень сложно изучать, потому что в него входит разнородная популяция — люди с таким множеством разных симптомов и маркеров крови. НДСТ не заразен.

      Клиническая картина

      В исследованиях пациентов, проведенных таким образом, наиболее частыми симптомами НДСТ являются:

      • Артралгия (боль в суставах).
      • Артрит (суставы опухшие и теплые, часто с покраснением вышележащей кожи).
      • Сыпь, обычно на лице, которая может усилиться под воздействием солнца.
      • Алопеция (выпадение волос).
      • Феномен Рейно (изменение цвета рук и ног в ответ на холод).
      • Язвы во рту (язвы во рту).
      • Ксерофтальмия (сухость глаз из-за уменьшения слезотечения).
      • Ксеростомия (сухость во рту из-за уменьшения слюноотделения).
      • Незначительная лихорадка (обычно ниже 100 ° F).
      • Светочувствительность (появление сыпи или других симптомов после пребывания на солнце).

      Некоторые люди также развиваются:

      • Лейкопения — снижение количества лейкоцитов (клеток, которые помогают бороться с инфекцией) в крови.
      • Анемия — уменьшение количества красных кровяных телец (клеток, переносящих кислород к тканям тела) в крови.
      • Тромбоцитопения — аномальное снижение количества тромбоцитов (частей, связанных со свертыванием крови).
      • Плеврит или перикардит — воспаление слизистой оболочки легких или сердца соответственно, которое может вызывать боль в груди, особенно при дыхании.
      • Невропатия — ненормальные нервные ощущения, обычно в пальцах рук или ног, от онемения до покалывания и боли.

      Проблемы с почками, печенью, легкими или мозгом в НДСТ почти не встречаются.

      У подавляющего большинства людей с НДСТ не развивается серьезное повреждение органов или опасное для жизни заболевание. Отличительной чертой НДСТ является его легкое течение и низкая вероятность прогрессирования до более серьезного состояния.

      «Критерии» — это список проблем, которые врач ищет для постановки диагноза.Пока нет общепринятых критериев для НДСТ, как и для многих других ревматических заболеваний. Однако недавно был предложен предварительный набор критериев (см. «Моска» в аннотированной библиографии ниже):

      Предварительные критерии классификации UCTD

      • Признаки и симптомы, указывающие на CTD, но не соответствующие критериям для любого из определенных CTD, в течение как минимум трех лет.
      • Наличие антинуклеарных антител (АНА), идентифицированных в двух разных случаях (антинуклеарные антитела, обнаруженные в крови, являются маркерами, которые могут указывать на то, что ваша иммунная система вырабатывает антитела к частям собственного тела человека, другими словами, ошибочно определяя их как вредные внешние захватчики).

      В настоящее время НДСТ диагностируется врачом клинически, когда симптомы, результаты лабораторных анализов и история болезни соответствуют обычным схемам, которые врачи видят в отношении этого заболевания. Он основан не только на соблюдении контрольного списка требуемых критериев. Однако по мере того, как врачи разрабатывают более конкретные критерии для НДСТ, будет легче изучить болезнь и узнать о ее причинах и лучших методах лечения.

      Лабораторные данные

      Иммунологические

      Некоторые маркеры в вашей крови указывают на возможное нарушение функции вашей иммунной системы.Хотя в большинстве исследований отмечается, что у большинства пациентов с НДСТ есть АНА, у людей с НДСТ можно увидеть широкий спектр иммунологических нарушений. Сюда могут входить:

      • Повышенная скорость оседания (также известная как скорость оседания эритроцитов или СОЭ), индикатор воспаления.
      • Антифосфолипидные антитела (которые могут повлиять на свертываемость крови и могут увеличить риск выкидыша).
      • Гипергаммаглобулинемия (избыток гамма-глобулина — часто называемого IgG — белка в крови, который участвует в процессе сопротивления инфекции).
      • Гипокомплементемия (пониженный уровень комплемента — белков, которые помогают уничтожать бактерии и другие клетки — обычно обозначаемые как C3 и C4).
      • Ложноположительный экспресс-анализ крови на сифилис (RPR) (это означает, что лабораторный тест указывает на сифилис, когда сифилиса на самом деле нет — это может быть доказано более сложным тестом).
      • Положительные доказательства других маркеров аутоиммунного заболевания, таких как антитела против двухцепочечной ДНК (анти-дцДНК), анти-Ro / SSA, анти-Smith (анти-SM), анти-RNP, ревматоидный фактор (RF), и антитела против Ku.

      Гематологический

      Как отмечалось выше, у пациентов с НДСТ также могут возникать некоторые заболевания крови — тромбоцитопения, лейкопения и анемия. Они редко бывают достаточно серьезными, чтобы потребовать одного лечения.

      Прогностическая ценность лабораторных данных

      В ходе исследований была предпринята попытка определить, какие из результатов лабораторных исследований, если таковые имеются, могут предсказать эволюцию НДСТ в волчанку или другие заболевания соединительной ткани.

      В исследовании 148 пациентов, у которых были обнаруживаемые антитела к Ro / SSA и диагноз НДСТ в течение по крайней мере одного года, лейкопения чаще встречалась у тех пациентов, у которых в конечном итоге развилось определенное заболевание соединительной ткани.Антитела против дцДНК предсказывали развитие СКВ (волчанка). Однако у большинства пациентов в этом исследовании, у которых развилось заболевание соединительной ткани, в конечном итоге был диагностирован первичный синдром Шегрена (50%), который проявляется сухостью глаз и сухости во рту.

      Другое исследование показало, что антитела против РНП в значительной степени коррелировали с феноменом Рейно и артритом. Антитела Anti-Ro / SSA также коррелировали с сухостью глаз и сухости во рту. Самое интересное, что у 82% исследованных был обнаружен простой профиль аутоантител, характеризующийся единственной специфичностью.Серологический профиль этих пациентов с НДСТ не изменился в течение периода наблюдения.

      Среди тех пациентов с НДСТ с признаками, более характерными для волчанки (так называемая «неполная волчанка»), в группе из 87 пациентов было отмечено, что повышение дцДНК и снижение С4 (один тип комплемента) были связаны с последующим развитием волчанки. Другие отметили, что присутствие гомогенной ANA (один из нескольких «паттернов» ANA, которые видны в микроскоп) и присутствие антител против Sm предсказывают развитие волчанки.

      Одно физическое открытие, которое, как считается, предсказывает эволюцию к определенному CTD, — это наличие аномалий в капиллярах (мельчайших кровеносных сосудах) в складках ногтей рук или ног. В одном исследовании участвовали 43 пациента с НДСТ; было обнаружено, что 23% пациентов с аномальными капиллярами прогрессировали до определенной склеродермии (также называемой системным склерозом). Подобные исследования показали, что скорость прогрессирования может быть даже выше. (Человек, которого это беспокоит, может попросить врача исследовать ногтевые ложечки под микроскопом.Однако аномалии капилляров ногтевого валика наблюдались при многих других заболеваниях, таких как дерматомиозит, волчанка, синдром Шегрена и псориаз.

      Исследование, проведенное совсем недавно с участием 94 пациентов, показало, что артрит, феномен Рейно и наличие светочувствительности были предикторами развития ДСТ. Только у 13 пациентов (13,8%) развилось определенное заболевание соединительной ткани, из которых у 8,5% — системная красная волчанка, у 4,2% — синдром Шегрена и у 1,1% — ревматоидный артрит.При последующем наблюдении почти все пациенты имели благоприятный исход, несмотря на это.

      Для пациентов всегда разумно обсудить лабораторные тесты со своими врачами и попросить объяснений относительно того, что эти тесты означают. Пациенты могут попросить копии результатов своих анализов хранить в домашней папке, чтобы они могли видеть, как результаты меняются — или не меняются — с течением времени.

      Дифференциальный диагноз

      Многие различные заболевания могут вызывать симптомы, сходные с симптомами НДСТ. Дифференциальный диагноз — это процесс, с помощью которого врач определяет, какое состояние вызывает симптомы.Это важно, потому что заболевания, которые могут вызывать такие симптомы, часто лечат совсем не так, как НДСТ.

      К другим четко определенным заболеваниям соединительной ткани, которые необходимо учитывать в процессе дифференциальной диагностики, относятся: ревматоидный артрит, системная красная волчанка (волчанка), миозит, синдром Шегрена и склеродермия. Распространенная боль в теле без других объективных признаков, даже при наличии положительной АНА, является более убедительным свидетельством фибромиалгии, чем аутоиммунное заболевание или заболевание соединительной ткани.

      Для исключения этих других ревматических заболеваний важен тщательный сбор анамнеза, обследование и лабораторное обследование. В этом смысле диагноз НДСТ является исключением. Когда подозрение на аутоиммунное заболевание у пациента высокое из-за наличия нескольких признаков одного или нескольких из этих заболеваний, но признаки и симптомы недостаточны для соответствия их критериям, диагностируется НДСТ. Однако порог для пересмотра более определенного CTD должен быть низким, если и когда у таких пациентов появляются новые симптомы.Как и в случае с большинством проблем, которые видят ревматологи, для постановки диагноза важнее всего то, что нам сообщает пациент, а не какой-либо конкретный тест.

      (Найдите специалиста в HSS, который лечит недифференцированное заболевание соединительной ткани.)

      Первичное лечение

      Официальных исследований различных методов лечения пациентов с НДСТ не проводилось. Большинство используемых методов лечения являются эффективными при других заболеваниях соединительной ткани. Однако неизвестно, в какой степени конкретная терапия улучшает симптомы НДСТ или снижает частоту обострения или вероятность развития более выраженного заболевания соединительной ткани.

      Большинство методов лечения симптоматические и включают:

      1. Анальгетики (болеутоляющие, такие как ацетаминофен) и нестероидные противовоспалительные препараты (НПВП), такие как ибупрофен, для лечения скелетно-мышечных симптомов, таких как боли в суставах и мышцах.
      2. Кортикостероиды для местного применения (кремы, лосьоны или гели, обладающие противовоспалительным действием).
      3. Противомалярийные таблетки, такие как гидроксихлорохин (Плаквенил) для лечения кожных и слизистых симптомов. (Было обнаружено, что противомалярийные препараты изменяют функцию иммунной системы.)

      При симптомах, не поддающихся лечению этими препаратами, врач может иногда назначать низкие дозы кортикостероидов в форме таблеток (например, преднизон) на короткие периоды времени. Высокие дозы кортикостероидов, других иммунодепрессантов (таких как азатиоприн, торговая марка Imuran) и цитотоксических агентов (таких как циклофосфамид, торговая марка Cytoxan) почти никогда не используются.

      Тем не менее, есть одно интересное исследование другого иммунодепрессанта, метотрексата (ревматрекс), в котором оценивалось его использование у пациентов с волчанкой, у которых не было заболевания почек, и у 15 пациентов с НДСТ, у которых наиболее частыми клиническими результатами были положительные ANA, неэрозивный полиартрит и феномен Рейно. .Общая эффективность была отмечена у 53% пациентов, в том числе у 6 из 10 пациентов с артритом; 60% имели побочные эффекты, а 33% прекратили прием препарата. Не исключено, что в некоторых случаях этот препарат может быть полезен при трудноизлечимых проблемах с суставами и кожей.

      Вопросы долгосрочного управления

      Беременность: исход, влияние на частоту обострений и развитие болезни

      Одно исследование 25 беременностей у 20 пациенток с диагнозом НДСТ в течение как минимум одного года показало, что 22 беременности были успешно доведены до срока.Осложнения наблюдались в 6 из 22 успешных беременностей, но эти осложнения в основном ограничивались ранними родами и более низкой массой тела при рождении. Некоторые системные аутоиммунные заболевания, как правило, имеют чередующиеся ремиссии (периоды отсутствия симптомов) и обострения (периоды повышенной активности болезни). В этом исследовании беременности обострения НДСТ наблюдались у шести пациенток с такими симптомами, как артрит, лихорадка и кожная сыпь. У одного пациента развилась системная красная волчанка. Частота обострений была выше, чем частота обострений в контрольной популяции небеременных пациенток с НДСТ.

      Исследование, проведенное в 2011 году по оценке исходов беременности у 55 пациенток с НДСТ, показало, что средняя продолжительность успешных беременностей составила 38,6 недель. Выкидыш был редким, всего у трех беременностей (5,4%). У 16 пациенток (32%) болезнь обострилась во время беременности или в течение шести месяцев после родов. Пятеро из них после родов разработали четко определенный CTD.

      Эти исследования показывают, что за вашим состоянием следует внимательно следить во время и после беременности.

      Возникновение заболеваний щитовидной железы

      Заболевание щитовидной железы, особенно гипотиреоз (недостаточная активность щитовидной железы), является распространенным аутоиммунным заболеванием, которое чаще встречается у пациентов с другими аутоиммунными заболеваниями, такими как волчанка и ревматоидный артрит.Одно небольшое исследование 75 пациентов с НДСТ показало, что заболевание щитовидной железы присутствовало у 6%, что позволяет предположить, что наблюдение за возникновением заболевания щитовидной железы со стороны врача может быть целесообразным.

      Прогноз

      Прогноз — это прогноз вероятного течения болезни. Пациенты с НДСТ имеют отличный прогноз. Почти все исследования на сегодняшний день указывают на низкую вероятность прогрессирования любого поражения таких органов, как почки, легкие или мозг. Менее чем у 20% пациентов развивается четко выраженное заболевание соединительной ткани, но данные показывают, что это становится гораздо менее вероятным, если болезнь сохраняется без изменений более пяти лет.

      У значительной части пациентов болезнь протекает в легкой форме и не требует лечения. В редких случаях у некоторых людей симптомы могут полностью исчезнуть. Большинство пациентов можно лечить симптоматически, и очень немногим пациентам когда-либо требуется использование иммунодепрессантов.

      Когда обращаться к специалисту

      Если ваш лечащий врач подозревает, что у вас может быть НДСТ — или если у вас есть какое-либо другое системное аутоиммунное заболевание или заболевание соединительной ткани, — вы должны быть осмотрены ревматологом для оценки и подтверждения диагноза.Консультация ревматолога важна, чтобы исключить наличие любого другого определенного заболевания соединительной ткани и получить соответствующее лечение, чтобы уменьшить вероятность прогрессирования.

      После того, как ваши симптомы стабилизируются с помощью эффективного медицинского лечения, ревматолог должен проводить постоянное наблюдение не реже двух раз в год. Обычно достаточно проверять функцию почек и печени и анализ крови несколько раз в год, если только не появятся новые симптомы. Любые новые симптомы следует незамедлительно оценивать, чтобы исключить развитие четко выраженного заболевания соединительной ткани, которое требует более агрессивного лечения.

      (Найдите специалиста в HSS, который лечит недифференцированное заболевание соединительной ткани.)

      Аннотированная библиография

      Аларкон GS. Неклассифицированное или недифференцированное заболевание соединительной ткани. Baillieres Best Practice Clin Rheumatol. 2000 Март; 14 (1): 125-37.
      Хороший обзор 10-летних клинических исходов НДСТ.

      Castellino G, Capucci R, Bernardi S, Padovan M, Giacuzzo S, Pivato E, Patella A, Trotta F, Govoni M., Беременность у пациентов с недифференцированным заболеванием соединительной ткани: Lupus.2011 Oct; 20 (12): 1305-11a проспективное исследование случай-контроль. Описанное количество пациенток с НДСТ, обострившихся во время беременности, составило около 11%. Некоторые из них после беременности переросли в более четко выраженный CTD.

      Guerrero LF1, Rueda JC, Arciniegas R, Rueda JM. Недифференцированное заболевание соединительной ткани в ревматологическом центре в Кали, Колумбия: клинические особенности 94 пациентов, наблюдаемых в течение года. Rheumatol Int. 2013 Апрель; 33 (4): 1085-8.

      Моска М., Нери Р., Бомбадиери С. Недифференцированные заболевания соединительной ткани (НДСТ): обзор литературы и предложение по предварительным критериям классификации.Clin Exp Rheumatol 1999, сентябрь-октябрь: 17 (5): 615-620. Обзор
      В этой статье рассматривается необходимость систематической классификации тех пациентов, которых лучше всего называть «недифференцированными». Предложены критерии классификации.

      Моска М., Нери Р., Стригини Ф., Карминьяни А., Тотти Д., Тавони А. и Бомбардьери С. Исход беременности у пациенток с недифференцированным заболеванием соединительной ткани: предварительное исследование на 25 беременностях. Волчанка 2002; 11 (5): 304-7.
      Это важное исследование показало, что пациенты с НДСТ подвержены более высокому риску осложнений беременности, и приводит аргументы в пользу тщательного наблюдения за этими пациентами во время беременности.

      Уильямс Х.Дж., Аларкон Г.С., Джокс Р., Стин В.Д., Булпитт К., Клегг Д.О., Зимински С.М., Лугген М.Э., СтКлер EW, Уиллкенс Р.Ф., Ярборо К., Морган Дж. Г., Эггер М.Дж., Уорд-мл. Раннее недифференцированное заболевание соединительной ткани (ДЗТ). VI. Исходная когорта через 10 лет: ремиссии болезни и изменения диагнозов при четко установленных и недифференцированных CTD. J Rheumatol 1999, 26 апреля (4): 816-25.
      Сюда входят данные о пациентах с НДСТ, наблюдаемых в течение более 10 лет (самое продолжительное задокументированное исследование), и делается важное наблюдение, что даже при столь отдаленном заболевании многие пациенты все еще не развились в более выраженный ДСТ.

      Обновлено: 05.07.2017

      Авторы

      Джессика Р. Берман, MD
      Помощник директора программы, стипендия ревматологов, Госпиталь специальной хирургии
      Заместитель лечащего врача, Госпиталь специальной хирургии

      Наследственные заболевания соединительной ткани: руководство к возникающему дифференциальному диагнозу

      В алфавитном порядке ниже перечислены дополнительные факты, дополняющие основную часть информации в таблицах.

      Аневризмы брюшной аорты

      Аневризмы брюшной аорты (ААА) могут присутствовать изолированно или как часть синдрома, такого как сосудистый синдром Элерса-Данлоса (EDS), синдром Лойса-Дитца или синдром Марфана. Идентифицированы три локуса для изолированного AAA: 19q13, 4q31 и 9p21. Однако большинство AAA имеют многофакторную этиологию. 9

      Синдром извитости артерий

      Синдром извитости артерий отличается от форм СЭД генерализованной извитостью артериального русла.Синдром извитости артерий может включать случайные проявления, такие как паховые и диафрагмальные грыжи, удлинение кишечника, кератоконус, макроцефалия, арахнодактилия, контрактуры суставов и гипотония, в дополнение к более частым признакам, перечисленным в таблице 1 (дополнительный цифровой контент 1, http: // ссылки .lww.com / GIM / A111). Характерные черты лица могут включать характерное удлиненное лицо, микрогнатию, маленький рот, высокое арочное небо, низко посаженные уши, длинный желобок, нос с клювом, наклонные глазные щели, длинные уши и отвисшие щеки. 10,11

      Двустворчатый аортальный клапан с аневризмой грудной аорты

      Двустворчатый аортальный клапан (BAV) с аневризмой грудной аорты (TAA) часто ассоциируется с кальцификацией аорты, 12 у людей и исследования на мышах и общая этиология через такие гены, как НОТЧ2 . 13–15 Лица с нормальным трехстворчатым аортальным клапаном в семьях с BAV / TAA также могут подвергаться риску кальцификации аортального клапана или TAA, особенно если они несут известную семейную мутацию в NOTCh2. 16 Рекомендации по клиническому ведению BAV / TAA могут включать фармакологическую терапию бета-блокаторами и ингибиторами ангиотензинпревращающего фермента или блокаторами рецепторов ангиотензина, агрессивный контроль гипертонии, ежегодную визуализацию восходящих аорт диаметром> 4,0 см и плановое хирургическое лечение расширенных аорты> 5,0 см в диаметре или> 4,5 см с дополнительными факторами риска. 16

      Болезнь Камурати-Энгельмана

      Болезнь Камурати-Энгельмана (CED) — редкая костная дисплазия, также известная как прогрессирующая диафизарная дисплазия, в группе заболеваний краниотубулярного гиперостоза, возникающих в результате активации мутаций в трансформирующем факторе роста β1 (TGF- β1), стимулятор роста костей.Сцинтиграфия скелета может использоваться для обнаружения КЭД даже на ранних стадиях. Помимо боли в конечностях (наиболее частый симптом), к другим диагностическим клиническим признакам относятся враждебность, легкая утомляемость и мышечная слабость. Об уменьшении подкожного жира и дефектах черепных нервов, включая потерю слуха, сообщается у части пациентов с КЭД. 17 CED и болезнь Риббинга (OMIM № 601477) являются фенотипическими вариациями одного и того же генетического заболевания.

      Синдром CATSHL

      Синдром CATSHL означает «камптодактилия, высокий рост и потеря слуха.Этот редкий синдром был идентифицирован в семье с миссенс-мутацией в домене тирозинкиназы FGFR3 , которая, по прогнозам, приведет к частичной потере функции. 18 Как правило, сильные корреляции генотип-фенотип характерны для расстройств, связанных с FGFR . Мутации в FGFR3 преимущественно влияют на кости, которые развиваются за счет эндохондральной оссификации, тогда как мутации в близкородственных генах, FGFR1 и FGFR2 , оказывают свое основное влияние на кости, развивающиеся за счет внутримембранозного окостенения. FGFR3 Мутации могут способствовать (как в случае CATSHL) или ингибировать (как при ахондроплазии) рост эндохондральной кости.

      Врожденная контрактурная арахнодактилия

      Врожденная контрактурная арахнодактилия (CCA) также известна как синдром Билса-Хехта. Классический дисморфизм уха предполагает появление «смятого» вида с загнутой верхней спиралью, хотя эта особенность не всегда присутствует. Медиальная дегенерация проксимального отдела аорты, ведущая к аневризме аорты и, возможно, ее расслоению, иногда наблюдается при ОСА и требует тщательного наблюдения.Контрактуры колен и лодыжек могут присутствовать при рождении и часто улучшаются с возрастом. Также возникают сгибательные контрактуры в мелких суставах пальцев, реже — контрактуры бедра, приведение большого пальца и косолапость. Также сообщалось о парадоксальной слабости надколенника, кератоконусе и стенозе пиелоуретерального перехода. Также была выявлена ​​редкая тяжелая / летальная форма ОСА, которая включает тяжелые сердечно-сосудистые и желудочно-кишечные симптомы. 19 Существенных клинических различий между FBN2-позитивными и FBN2-негативными пациентами не наблюдалось, что свидетельствует о гетерогенности локуса. 20 У FBN2-положительных пациентов частота вывихов суставов значительно выше при миссенс-мутациях FBN2 по сравнению с мутациями сайтов сплайсинга. 21 Доля случаев de novo неизвестна, но у многих пациентов с диагнозом ОСО есть заболевший родитель. 22

      Cutis laxa, аутосомно-доминантный

      Cutis laxa, аутосомно-доминантный (ADCL) первоначально предполагалось, что включает незначительные системные проявления; однако аневризмы грудной аорты, паховые грыжи и эмфизема теперь признаны серьезными потенциальными клиническими проявлениями. 23–25

      Cutis laxa, аутосомно-рецессивный тип I

      Cutis laxa, аутосомно-рецессивный AR типа I (ARCLI) имеет худший прогноз в отношении кутис-лаксуса и считается менее распространенным, чем ARCLII. Легочные проявления при ARCLI включают тяжелые сердечно-легочные поражения, включая инфантильную эмфизему и / или надклапанный стеноз аорты. Существуют клинические различия между ARCLI, вызванным FBLN4 и FBLN5 ; например, только FBLN4 было связано с аномалиями, связанными с коллагеном, такими как хрупкость костей и аневризмы артерий среднего размера. 26,27 Генетическая основа большинства случаев ARCLI остается неизвестной. Недавно Morava et al. 28 опубликовали всестороннее сравнение аутосомно-рецессивных синдромов кутислакса.

      Аутосомно-рецессивный тип II Cutis laxa

      Аутосомно-рецессивный тип II Cutis laxa (ARCLII) часто включает характерную фацию с наклонными вниз глазными щелями, коротким носом и маленьким ртом. Поражение центральной нервной системы и системное поражение варьируют, часто присутствует микроцефалия.Фенотип кожи имеет тенденцию ослабевать с возрастом, тогда как неврологические симптомы могут проявляться или ухудшаться в более позднем возрасте. Большой передний родничок закрывается поздно. Многие пациенты с ARCLII имеют врожденный дефект гликозилирования (CDG тип II, мутация ATP6V0A2), тогда как у других есть дефекты биосинтеза пролина, связанные с морщинистой кожей, остеопенией и появлением прогероидов (мутации PYCR1, P5CS). 29,30 Анализ изоэлектрического фокусирования аполипопротеина C-III, демонстрирующий нарушение O -гликозилирования, является диагностическим, и изоэлектрическое фокусирование трансферрина также может быть нарушено.Оценка статуса гликозилирования белков рекомендуется всем детям с врожденными морщинами кожи / кутис-лаксой, поздним закрытием родничка, задержкой развития и вариабельным поражением ЦНС. Синдром морщинистой кожи (OMIM № 278250) и ARCLII являются частью спектра фенотипических вариаций, вызванных дефектами одного гена. 31 Фенотип может также перекрываться с остеодисплазией геродермии (OMIM № 231070) и синдромом де Барси (OMIM № 219150).

      Cutis laxa, X-connected

      Cutis laxa, X-connected (XLCL) также известен как синдром затылочного рога из-за наличия диагностических двусторонних симметричных клиновидных костных выростов рядом с большим затылочным отверстием на месте трапеции и прикрепление грудино-ключично-сосцевидной мышцы.Может наблюдаться чрезмерная растяжимость запястья и межфаланговых суставов, но могут наблюдаться контрактуры локтя и колена. Черты лица могут включать крючковатый нос и длинный желобок, характерные для кутислакса в целом. Нарушение нормального развития может быть связано с хронической диареей, мальабсорбцией, врожденным гидронефрозом или дивертикулами уретры и мочевого пузыря. 27 Умственная отсталость может присутствовать или отсутствовать. XLCL — это болезнь транспорта меди, аллельная с болезнью Менкеса (OMIM № 309400), часто имеющая черту ломкости волос.Церулоплазмин в сыворотке может быть низким или нормальным, а активность лизилоксидазы также может быть снижена.

      Ectopia lentis, семейная

      Ectopia lentis, семейная вызывается мутациями в FBN1 , которые, как предполагается, нарушают нормальное образование дисульфидных связей и структуру нативного белка. 30 Глаукома может быть вторичной по отношению к подвывиху хрусталика. Хотя мутации в FBN1 приводят к аутосомно-доминантной изолированной эктопии lentis, также описаны аутосомно-рецессивные вариации, некоторые из которых связаны с мутациями в LTBP-2 32 и ADAMTSL4 33 .В трех семьях с аутосомно-рецессивной эктопией lentis из-за мутаций в LTBP-2 наблюдалась остеопения от легкой до умеренной у носителей и пораженных лиц, а также высокое арочное небо, хотя никаких других признаков, совпадающих с синдромом Марфана, не было, тогда как во всех случаях с мутациями LTBP-2 -null в четвертом семействе имелись марфаноидные особенности скелета и суставов без остеопении. 32 Ectopia lentis может также возникать в сочетании с легкими скелетными симптомами, пролапсом митрального клапана или непрогрессирующей дилатацией корня аорты, особенно из-за мутаций в FBN1 .У некоторых пациентов с диагнозом семейная эктопия lentis может развиться аневризма аорты в более позднем возрасте, и их можно рассматривать как поздние формы синдрома Марфана. Ectopia lentis также была идентифицирована у подгруппы пациентов с мутациями TGFBR2 и минимальными скелетными признаками. 34

      Синдром Элерса-Данлоса, тип артрохалазии (EDS тип VIIA, VIIB)

      Синдром Элерса-Данлоса, тип артрохалазии (EDS тип VIIA, VIIB) отличается от других типов EDS высокой частотой ранних проявлений врожденный вывих бедра, крайняя слабость суставов с периодическими подвывихами суставов (больших и малых, особенно бедер) и минимальное поражение кожи.Гиперэластичность кожи обычно незначительна. Люди с типом EDS артрохалазии могут иметь в анамнезе частые переломы, фенотипическое совпадение с несовершенным остеогенезом, а также низкий рост. 35 Патологической основой этого расстройства является неспособность α-1 или α-2 цепей проколлагена типа I превращаться в коллаген из-за мутаций, изменяющих сайт расщепления проколлагена.

      Синдром Элерса-Данлоса, клапанный тип сердца

      Синдром Элерса-Данлоса, клапанный тип сердца может иметь типичное поражение кожи и суставов, характерное для классических EDS (хотя и не всегда), а также повышенный риск поражения сердечного клапана.Это очень редкий вариант EDS, на сегодняшний день описано лишь несколько пациентов. Молекулярная основа — полное отсутствие цепей коллагена proα2 (I) в результате гомозиготности или гетерозиготности по нулевым мутациям COL1A2 . 36 Сердечно-клапанный EDS является относительно мягким вариантом в спектре клинических фенотипов, возникающим в результате мутаций COL1A2 , который также включает несовершенный остеогенез. В отличие от несовершенного остеогенеза, при EDS сердечного клапана не наблюдается скелетных аномалий.Тип сердечного клапана EDS может перекрываться с легкой формой EDS типа гипермобильности в детстве, с сердечными клапанными осложнениями, возникающими во взрослом возрасте. 37

      Синдром Элерса-Данлоса, классический тип (EDS тип I, II)

      Синдром Элерса-Данлоса, классический тип (EDS тип I, II) характеризуется кожей, которая часто бывает гладкой и бархатистой. Атрофическое рубцевание — ключевая находка дерматологии. Типичные черты лица могут включать эпикантические складки, избыток кожи век и преждевременный возраст.Он отличается от типа гипермобильности, который имеет гораздо более тонкие кожные проявления. У педиатрических пациентов у детей могут быть синяки. 38 Дефекты коллагена V типа (COL5A1 и COL5A2) выявляются примерно в 50% классических случаев EDS. Основные и второстепенные диагностические особенности шести общепризнанных типов СЭД см. В пересмотренной нозологии, созданной Национальным фондом Элерса-Данлоса (США) и Группой поддержки Элерса-Данлоса (Великобритания). 39

      Синдром Элерса-Данлоса, тип дерматоспараксиса (тип EDS VIIC)

      Синдром Элерса-Данлоса, тип дерматоспараксиса (тип EDS VIIC) характеризуется крайней хрупкостью кожи.Пациенты с EDS типа дерматоспараксиса могут демонстрировать отсроченное начало типичного фенотипа, и, следовательно, младенцы из группы риска могут нуждаться в последующем наблюдении в течение первых 2 лет. Дисморфизм лица может включать полноту век, эпикантальные складки и наклонные вниз глазные щели. Могут наблюдаться голубые склеры. В молочных и постоянных зубах может быть множество аномалий. 40 Подобно типу артрохалазии EDS, тип дерматоспараксиса вызывается недостаточностью переработки проколлагена в коллаген.Хотя тип артрохалазии EDS вызывается мутациями в COL1A1 или COL1A2, тип дерматоспораксиса включает мутации в гене протеазы ADAMTS-2. 41

      Синдром Элерса-Данлоса, кифосколиотический тип (EDS тип VI)

      Синдром Элерса-Данлоса, кифосколиотический тип (EDS тип VI) отличается от других типов EDS большой задержкой моторного развития в результате мышечной гипотонии в сочетании с суставной гипотонией. вялость. Из-за этих клинических особенностей дифференциальная диагностика младенцев с кифосколиотической EDS может первоначально включать врожденные мышечные дистрофии, врожденные миопатии и заболевания нижних мотонейронов.Подростки с этой формой EDS могут иметь общую мышечную слабость в дополнение к снижению мышечного тонуса при остальной гипотонии. 42 Кифосколиотический EDS следует рассматривать, если результаты нервно-мышечных тестов нормализовались, контрактуры отсутствуют и присутствует марфаноидный габитус. Диагноз кифосколиотической EDS может быть подтвержден биохимически по значительно увеличенному соотношению общего лизилпиридинолина в моче и гидроксилизилпиридинолина. 43,44

      Синдром Элерса-Данлоса, прогероидный тип

      Синдром Элерса-Данлоса, прогероидный тип — это врожденное нарушение гликозилирования, такое как кутислакса AR типа II. 45 Как следует из названия, этот тип EDS может характеризоваться выраженным прогероидным обликом, а также морщинистостью кожи лица, тонкими вьющимися волосами, скудными бровями и ресницами и наклонными глазными щелями. Также типичны задержка развития и аномалии скелета. Кожа может быть рыхлой, но все же эластичной. В фенотипе кожи виден спектр степени тяжести, который может быть таким же легким, как легкие морщинки на лице и не выраженная дряблость кожи. 46

      Синдром Элерса-Данлоса, спондилохейродиспластический тип

      Синдром Элерса-Данлоса, спондилохейродиспластический тип (SCD-EDS) характеризуется кожей, которая описывается как гладкая, бархатистая, тонкая, хрупкая и полупрозрачная с атрофической рубцовой бумагой. , как в классической EDS.Кожа на руках и ногах может выглядеть морщинистой и преждевременно стареющей, а пальцы описываются как тонкие и сужающиеся. Небольшие контрактуры суставов и значительная атрофия мышц тенара и гипотенара могут ограничивать мелкую моторику и придают рукам внешний вид, аналогичный таковому при синдроме дефицита Lh4. Задержка роста наступает постнатально. Для этого заболевания характерны выпученные глаза с наклонными вниз глазными щелями и голубоватые склеры. Плоскостопие (pes planus), частое явление при заболеваниях соединительной ткани, также характерно для SCD-EDS.Люди с SCD-EDS могут демонстрировать характерную походку вразвалку и испытывать боли в коленях и бедрах при ходьбе. 47

      Синдром Элерса-Данлоса, сосудистый тип (EDS тип IV)

      Синдром Элерса-Данлоса, сосудистый тип (EDS тип IV) возникает из-за уменьшения или отсутствия нормального коллагена типа III в средней оболочке крупных эластичных артерий . Это предрасполагает людей к аномалиям в основных кровеносных сосудах и возникающим в результате аневризмам, спонтанному разрыву сосудов, расслоениям и артериовенозным свищам.Люди с сосудистым EDS проявляют крайнюю кровоподтёку. Обычно разрывы полых органов включают кишечник, особенно толстую кишку, и матку, что делает беременность очень рискованной для женщин с сосудистой EDS. Проявления легких, хотя и менее распространены, недавно были зарегистрированы и могут включать рецидивирующее кровохарканье, спонтанный пневмоторакс или образование пузырей и пузырей. Отличительные черты лица могут включать акрогерию, характеризующуюся тонким лицом с выступающими костями; впалые щеки; тонкий, защемленный нос; выпученные глаза; и тонкие губы. 48,49 Гиперэластичность кожи и гипермобильность суставов ограничены в сосудистых EDS. Большинство случаев семейных сосудистых EDS наследуются по аутосомно-доминантному типу, хотя был идентифицирован случай рецессивно наследуемой сосудистой EDS. 50 Существует значительное фенотипическое перекрытие между сосудистыми EDS и семейными артериальными аневризмами. Важно различать синдром Лойса-Дитца и сосудистую EDS из-за значительно более высокой интраоперационной смертности, связанной с последним. 51

      синдром Элерса-Данлоса, дефицит тенасцина X

      синдром Элерса-Данло, дефицит тенасцина X (TNX) характеризуется гипермобильными суставами, гиперэластичной кожей и очень легкими синяками, но без атрофических рубцов или плохого состояния. заживление ран, наблюдаемое в классической EDS. Другие серьезные медицинские проблемы, возникающие у людей с этим заболеванием, включают тяжелое дивертикулярное кишечное заболевание (например, панколоническое) с разрывом дивертикулов, желудочно-кишечное кровотечение, пролапс прямой кишки, пролапс митрального клапана, требующий замены клапана, и хроническое обструктивное заболевание дыхательных путей.Исследования аномальной нервной проводимости, указывающие на полинейропатию, распространены и значительно чаще встречаются при EDS с дефицитом тенасцина-X по сравнению с другими формами EDS. 52 Хотя это рецессивное состояние, до 2/3 женщин, гетерозиготных по дефициту TNX, могут иметь изолированную гипермобильность суставов. Для пациентов с EDS с дефицитом TNX следует рассмотреть менее инвазивные альтернативы эндоскопии из-за теоретического риска перфорации кишечника. Всем пациентам с СЭД с дефицитом TNX рекомендуется базовое легочное исследование, а курящих пациентов следует настоятельно рекомендовать бросить из-за риска развития ХОБЛ. 53 Делеции смежных генов, включающие как гены тенасцина X, так и гены 21-гидроксилазы, могут привести к врожденной гиперплазии надпочечников с дефицитом тенасцина X. 54,55

      Семейная аневризма грудной клетки и / или расслоение

      Семейная аневризма и / или расслоение грудной клетки (FTAAD) приводит к наследственному расширению, аневризме и расслоению аорты. 56 Церебральные сосуды также могут быть поражены веретенообразными аневризмами или извитостью. Множественные гены, большинство из которых действуют аутосомно-доминантным образом, вызывают FTAAD, а сцепление с другими локусами указывает на то, что дополнительные гены ждут открытия.Было обнаружено, что сокращение гладкомышечных клеток важно для поддержания структурной целостности грудной / восходящей аорты и мутаций в генах, кодирующих α-актин гладкомышечных клеток ( ACTA2 ) и тяжелую цепь β-миозина ( MYh21 ). ) были идентифицированы как причины FTAAD. 57 Мутации в ACTA2 являются наиболее частой причиной FTAAD и могут быть связаны с livedo reticularis, iris flocculi, PDA и BAV. FTAAD, вызванный мутациями TGBFR, часто включает в себя скелетные проявления заболевания соединительной ткани (например, гипермобильность суставов, плоскую стопу, долихоцефалию или сильно искривленное небо), которые не соответствуют диагностическим критериям конкретного синдрома.Были выявлены различия в клинической картине между людьми с FTAAD из-за TGFBR1 и TGFBR2, включая увеличение заболеваемости раком с TGFBR1 по сравнению с TGFBR2 и лучшую выживаемость женщин с сосудистыми заболеваниями из-за мутации TGFBR1 без гендерных различий, наблюдаемых в TGFBR2. 58 Подробный обзор молекулярных основ FTAAD был опубликован Milewicz et al. 59 в 2008 году.

      Синдром ломкой Х-хромосомы

      Синдром ломкой Х-хромосомы, также известный как синдром Мартина-Белла, является наиболее частой причиной Х-связанной умственной отсталости.Синдром включает множество клинических признаков нарушения соединительной ткани, а в тканях кожи и сердца людей с синдромом ломкой Х-хромосомы обнаруживаются эластиновые волокна, которые аберрантно распределены и структурированы. 60,61 Pes planus — частая находка со стороны опорно-двигательного аппарата в дополнение к перечисленным в Таблице 1 (Дополнительный цифровой контент 1, http://links.lww.com/GIM/A111). Черты лица могут быть тонкими; характерное лицо — длинное, с высоким лбом, большой челюстью и выступающим подбородком, а уши характерно большие и низко посаженные.В одном исследовании косоглазие (но не синяя склера) присутствовало примерно у половины больных. 60 У больных могут проявляться черты аутизма. Поведенческие и когнитивные проявления чаще всего включают в себя сочетание плохого зрительного контакта, персеверативной речи, эхолалии, плохой концентрации внимания, гиперактивности и необычных манер рук; Пациент с этим характерным лицом, дряблостью суставов, макроорхизмом, семейной историей умственной отсталости и любыми психиатрическими проявлениями, перечисленными выше, должен быть обследован на предмет синдрома ломкой Х-хромосомы.Женщины-носительницы с преждевременной мутацией Fragile X подвержены риску преждевременной недостаточности яичников. Премутации также связаны с синдромом тремора и атаксии. 62

      Гомоцистинурия

      Гомоцистинурия возникает из-за дефицита цистатионин-бета-синтазы (CBS). Существует высокий риск заболеваемости и смертности из-за тромбоза сосудов и инсульта. 63 Клинические ключи к диагнозу включают генерализованную гипопигментацию, панкреатит, малярный прилив и ретикулярную ливедо.При гомоцистинурии подвывих хрусталика обычно направлен вниз, тогда как при синдроме Марфана хрусталик обычно смещен вверх. Психоневрологическое заболевание часто встречается у нелеченных пациентов.

      Синдром дефицита Lh4

      Синдром дефицита Lh4 может проявляться характерной чертой мелких глазниц, маленьким носом, загнутыми вниз уголками рта, плоским профилем лица и низко посаженными упрощенными ушами. Могут присутствовать остеопения и переломы, а задержка роста бывает как внутриутробной, так и послеродовой.В дополнение к признакам, перечисленным в Таблице 2 (Дополнительный цифровой контент 2, http://links.lww.com/GIM/A112), присутствовали нерубцовые волдыри на коже, гипопластические ногти, спонтанное кровотечение и катаракта. Выявлен прогрессирующий сколиоз, но не деформации грудной клетки. Косолапость (эквиноварусная косолапость), контрактуры мелких суставов и атрофия мышц тенара и гипотенара сходны со спондилохейродиспластической формой EDS. Считается, что клинические признаки дефицита Lh4 (лизилгидроксилазы 3) связаны с потерей активности глюкозилтрансферазы Lh4, которая обычно модифицирует пиридинолиновые поперечные связи коллагена внеклеточно посредством гликозилирования гидроксилизина.Таким образом, отсутствие в моче дисахаридного производного пиридинолина (Glc-Gal-PYD) является биохимически диагностическим, но еще не доступно клинически. 64

      Синдром Лойса-Дитца

      Синдром Лойса-Дитца имеет континуум проявлений, которые обычно включают как сосудистые, так и скелетные признаки и делятся на два типа на основе третьей основной задействованной системы. Черепно-лицевые находки особенно заметны у LDS типа I, на долю которого приходится около трех четвертей LDS.Кожные изменения наблюдаются у четверти пациентов с LDS II. Эти особенности разрыва органа и сосудистых событий аналогичны тем, которые наблюдаются при EDS сосудов. Как и в классической EDS, в LDS II кожа может быть описана как полупрозрачная и бархатистая. Корреляция генотип-фенотип не объясняет различия между LDS I и LDS II. мутации TGFBR1 составляют 25% пациентов с LDS и мутации TGFBR2 составляют 75% пациентов с LDS без корреляции с типом. 65 При обоих типах LDS сосудистые проявления имеют тенденцию быть более серьезными, чем при синдроме Марфана, и требуют более агрессивного скрининга и лечения. Пневмоторакс является основным легочным проявлением синдрома Лойса-Дитца. Органы, включая селезенку, кишечник и матку, подвержены риску разрыва. Грыжи часто повторяются. Помимо эктазии твердой мозговой оболочки нейрорадиологические исследования могут включать проявление типа I по Арнольду-Киари, но это может быть относительно редко. У меньшинства пациентов с LDS будет задержка в развитии.

      Синдром Лухана

      Синдром Лужана также известен как синдром Лужана-Фринса. Психиатрические проявления могут включать сочетание гиперактивности, эмоциональной лабильности, застенчивости, агрессивности, аутичных манер и психозов. 66 Основным структурным дефектом мозга является некоторая агенезия мозолистого тела. Характерные черты синдрома Лухана — длинные и тонкие, с высоким лбом, коротким желобком и иногда микрогнатиями. Другие отличительные особенности, не упомянутые в таблице 2, включают гиперназальный голос и макроцефалию.Для получения дополнительной информации о дифференциальной диагностике синдрома Лухана см. Van Buggenhout and Fryns 67 и Staholpu et al. 68 Синдром FG типа 1, также известный как синдром Опица-Каведжиа типа 1, является аллелем синдрома Лухана 69 и имеет много общих клинических признаков, но ни одной из них не является типично марфаноидным. Анальные аномалии или запоры ограничиваются синдромом ФГ, а высокий рост, длинные руки и пальцы, а также гиперназальная речь, возникающая из-за высокого носового корня, более характерны для ЛС. 70 Синдром Лухана и синдром FG вызваны мутациями в MED12 . Мутации в UPF3B также были идентифицированы в семьях с фенотипом Lujan-Fryns и фенотипом FG. 71

      Синдром MACS (макроцефалия, алопеция, кутислакса и сколиоз)

      Синдром MACS (макроцефалия, алопеция, кутислакса и сколиоз) — это недавно описанное наследственное заболевание соединительной ткани, основанное на трех членах двух родственных семей. . 72 Ожидается, что клинические проявления будут развиваться по мере выявления большего числа людей с мутациями RIN2 .Макроцефалия и ретрогнатия являются преобладающими черепными аномалиями. Алопеция относится к редким волосам на коже головы, наблюдаемым при этом заболевании. Cutis laxa наиболее заметна на лице, также может присутствовать ихтиоз легкой степени. Тяжелый сколиоз появляется на втором десятилетии жизни (а не при рождении, как при кифосколиотической EDS), что приводит к низкому росту. Характерные черты лица включают наклонные глазные щели, опухшие веки, обвисшие щеки и вывернутую нижнюю губу. Орто- и пародонтальные проявления включают неправильное положение зубов (неправильно расположенные или непрорезавшиеся) и гиперплазию десен.Кожный фенотип становится более выраженным с возрастом в отличие от ARCLII, при котором кожные проявления со временем ослабевают. Биопсия кожи пораженных лиц выявила дефицит фибулина-5 и уменьшение микрофибрилл в дерме. Черты лица напоминают синдром GAPO (задержка роста, псевдоанодонтия, атрофия зрительного нерва) (OMIM № 230740), редкое аутосомно-рецессивное заболевание, которое фенотипически более тяжелое и включает глазные аномалии, и EDS типа дерматоспараксиса, который также имеет гиперплазию десен, но отличается наличие прозрачной, легко покрывающейся синяками кожи.

      Синдром Марфана

      Диагноз синдрома Марфана является клиническим диагнозом, основанным на пересмотренных критериях консенсуса Гента. Для постановки диагноза требуются основные клинические признаки по крайней мере в двух системах и более легкие или менее специфические клинические признаки в третьей системе. 73 Находки скелета включают высокий рост по сравнению с другими членами семьи (по крайней мере частично из-за непропорционально длинных конечностей), длинные пальцы (арахнодактилия), переднюю деформацию грудной клетки, включая выпячивание (pectus carinatum) или вдавленный вид (pectus excatum) грудины и передние ребра, что связано с разрастанием ребер, слабостью суставов или контрактурами, сколиозом и черепно-лицевыми проявлениями, включая сильно выгнутое небо, скученные зубы и неправильный прикус.Эктазия твердой мозговой оболочки — главный диагностический клинический критерий пояснично-крестцового отдела позвоночника. Офтальмологические находки включают миопию, подвывих хрусталика (ectopia lentis), увеличенную осевую длину глазного яблока и плоскостность роговицы. Сердечно-сосудистые заболевания включают пролапс митрального клапана, митральную регургитацию, аортальную регургитацию и дилатацию корня аорты на уровне синусов Вальсальвы, что может привести к аневризме и / или расслоению. Кожные особенности включают стрии и рецидивирующие грыжи.Поражение дыхательных путей может проявляться в виде пузырей в легких, которые предрасполагают к пневмотораксу. FBN1 Мутации наследуются примерно в двух третях случаев и возникают de novo в остальных случаях. Описаны сотни из мутаций FBN1 , и их число продолжает расти. Было установлено немного корреляций генотип-фенотип из-за крайней аллельной гетерогенности в рамках синдрома Марфана и генетически связанных заболеваний. 74–77 Хотя нет известной генетической гетерогенности синдрома Марфана, мутации TGFBR2 также были обнаружены у пациентов с марфан-подобными фенотипами.Клинические исходы кажутся аналогичными таковым у пациентов с мутациями FBN1 , причем прогноз в любой группе больше зависит от клинического проявления заболевания и лечения, чем от ответственного гена. Было обнаружено, что пациенты с мутациями FBN1 имели более обширное поражение скелета, тогда как пациенты с мутациями TGFBR2 имели более тяжелые аортальные фенотипы в целом. 34

      Фенотип MASS

      Фенотип MASS указывает на участие MASS.Расширение аорты пограничное и непрогрессирующее, а кожные и скелетные изменения неспецифичны. Эти клинические характеристики в значительной степени совпадают с характеристиками синдрома Марфана и обеспечивают четкое свидетельство системного дефекта внеклеточного матрикса, но их недостаточно для диагностики синдрома Марфана. Таким образом, фенотип MASS является частью клинического континуума расстройств FBN1 , который варьируется от синдрома Марфана до отдельных признаков, таких как эктопия lentis. 78 Следовательно, трудно отличить фенотип MASS от ранних стадий синдрома Марфана при оценке людей, особенно детей, при отсутствии семейного анамнеза.Поэтому показан периодический сердечно-сосудистый мониторинг.

      Синдром пролапса митрального клапана

      Синдром пролапса митрального клапана (ПМК) относится к случаям идиопатического ПМК, в которых исключены другие нарушения сердечной и соединительной ткани. Синдром ПМК связан с системными особенностями, которые могут включать боль в груди, одышку, деформацию грудной клетки (включая узкий диаметр А-П), аритмию, легкую слабость суставов и длинные конечности. Пролапс возникает, когда створки митрального клапана поднимаются в левое предсердие и, по оценкам, присутствуют в 2.4% населения в целом, с возрастной и половой пенетрантностью. 79 MVP может быть спорадическим или семейным, изолированным или быть частью синдрома. 80 На сегодняшний день не описано никаких специфических генов для MVP, хотя были идентифицированы три аутосомных и один X-сцепленный локусы. Прогноз при синдроме ПМК лучше, чем при ПМК при синдроме Марфана, со значительно меньшим риском митральной регургитации.

      Стойкий открытый артериоз протока с семейной аневризмой грудной клетки

      Стойкий открытый артериоз протока с семейной аневризмой грудной клетки (ОАП с FTA) является моногенным патофизиологическим субъектом в гетерогенной группе заболеваний TAA.Это вызвано мутациями в специфической области гена тяжелой цепи миозина MYh21 гладкомышечных клеток, которые связаны с выраженной жесткостью аорты даже у бессимптомных лиц с гаплотипом заболевания. 81–83 Риск у пациентов с КПК с FTA можно оценить с помощью неинвазивного измерения эластичности и растяжимости аорты с помощью МРТ. FTA без КПК также вызывается мутациями MYh21 . MYh21 редко участвует в спорадически изолированном КПК. 84

      Синдром Шпринцена-Гольдберга

      Синдром Шпринцена-Голдберга (SGS) имеет много общих клинических проявлений с MFS и LDS, предполагая, что SGS также может действовать через нарушение сигнальных путей TGF-β, хотя уникальных генетических локусов еще не было. учредил. Идентификация мутаций TGFBR1 , TGFBR2 и FBN1 у некоторых пациентов с диагнозом SGS предполагает, что признание SGS как отдельного патогенетического объекта может быть неуместным, хотя проблема остается спорной. 85–87 Характерные черты лица SGS могут включать гипертелоризм, наклонные вниз глазные щели, сильно выгнутое небо, микрогнатию, проптоз (выпученные глаза) и низко посаженные, повернутые назад уши. 88 Наличие этого характерного лица, краниосиностоз и умственная отсталость являются основными признаками, используемыми для клинического отличия SGS. Другие особенности включают аномалию Киари, аномалии ребер и эквиноварусную деформацию (косолапость). SGS отличается от синдрома Гольдберга-Шпринцена (OMIM №609640) и синдром Шпринцена (OMIM № 192430).

      Синдром Снайдера-Робинсона

      Синдром Снайдера-Робинсона — это редкий Х-сцепленный синдром умственной отсталости с марфаноидными особенностями скелета, сходными с синдромом Лухана. Другие характерные особенности этого синдрома включают асимметрию лица с выступающей нижней губой, носовой голос, неустойчивую походку, неспецифическое двигательное расстройство, аномалии ЭЭГ, судороги и уменьшение мышечной массы. 89–91

      Синдром Стиклера

      Синдром Стиклера — относительно частое заболевание соединительной ткани.Катаракта и глаукома могут сопровождать другие офтальмологические находки в Таблице 2 (Дополнительный цифровой контент 2, http://links.lww.com/GIM/A112). Также может присутствовать легкая спондилоэпифизарная дисплазия, а потеря слуха может быть кондуктивной и нейросенсорной. Также часто наблюдаются плоское лицо и увеличенные колени. Наличие некоторых клинических признаков, включая отслоение сетчатки, катаракту, нейросенсорную тугоухость, дегенеративное заболевание суставов с ранним началом и некоторые аномалии скелета, является функцией возраста.Молекулярный анализ может помочь в диагностике расстройства, но не очень полезен для прогнозирования фенотипического проявления заболевания, за исключением глазных проявлений. 92 Клинически распознаются два витреоретинальных фенотипа. 93 Мутации в COL2A1 связаны с «мембранным» фенотипом стекловидного тела типа 1. Поскольку экзон 2 COL2A1 преимущественно экспрессируется в глазу, мутации в этом экзоне приводят к изолированному дефекту стекловидного тела 1 типа. 94 Менее распространенный фенотип стекловидного тела типа II связан с мутациями в COL11A1 . Мутации в COL11A2 вызывают фенотип Stickler, лишенный проявлений стекловидного тела, поскольку COL11A2 не экспрессируется в этой ткани. 95

      Синдром Вейля-Марчесани

      Синдром Вейля-Марчесани (WMS) демонстрирует значительную клиническую однородность, несмотря на его генетическую гетерогенность. При сравнении аутосомно-доминантного (AD — из-за FBN1 ) и аутосомно-рецессивного (AR — из-за ADAMTS10 ) WMS не было обнаружено значительных различий в частоте большинства клинических признаков. 96 Между AR и AD WMS была примерно 20% разница в частоте случаев микросферофакии и сердечных аномалий (более распространенных в AR WMS), а также суставных ограничений и эктопии lentis (более распространенных в AD WMS), 97 хотя эти характеристики обычно встречаются в обеих формах WMS. Еще больше усложняя дифференциацию между AR и AD WMS на основе семейного анамнеза, некоторые гетерозиготы для AR WMS демонстрируют легкие клинические проявления заболевания, включая низкий рост, брахидактилию и патологические результаты гониоскопии.Помимо глазных проявлений, перечисленных в Таблице 2 (Дополнительный цифровой контент 2, http://links.lww.com/GIM/A112), особенностями WMS могут быть мелкие орбиты и глаукома. Врожденные сердечные аномалии, сообщаемые у пациентов с WMS, включают ПМК, удлиненный интервал QT и стенозы легочного и аортального клапана. Пациентам с WMS и в анамнезе сердцебиение, головокружение, головокружение или обмороки следует обследовать на предмет удлинения интервала QTc, так как это может быть связано с серьезной аритмией. 98 Дифференциальный диагноз WMS включает синдром Хантера-Макдональда. 99

      Дисплазия Найта | Детская больница Филадельфии

      Дисплазия Книста — чрезвычайно редкое нарушение роста костей, которое приводит к низкому росту, неправильному развитию костей и суставов, а также к аномалиям скелета. Он диагностируется только один раз на 1 миллион рождений.

      Отличительной чертой дисплазии Книста являются сотни маленьких отверстий в костном хряще, которые на рентгеновском снимке делают его похожим на швейцарский сыр. Отверстия ослабляют хрящ, который служит соединительной тканью по всему телу, и вызывает скованность суставов и отек.

      Считается одной из нескольких форм карликовости, дети с дисплазией Книста рождаются с коротким туловищем и укороченными руками и ногами. У них также могут быть черепно-лицевые аномалии, такие как плоское лицо, выпученные глаза, короткая шея и / или волчья пасть. Деформации конечностей, такие как косолапость, также часто встречаются при дисплазии Книста.

      По мере взросления у детей с дисплазией Книста часто возникают проблемы со здоровьем, требующие лечения, такие как сколиоз, скованность суставов, а также проблемы со слухом и зрением.

      Дети с дисплазией Книста обладают нормальным интеллектом. Заболевание было названо в 1952 году в честь немецкого врача Вильгельма Книста.

      Дисплазия Найста вызвана случайным генетическим изменением. Обычно спорадический, это результат генетического дефекта кодирования коллагена типа II (COL2A1). Большинство мутаций Kniest вызвано небольшими генетическими изменениями на хромосоме 12.

      Большинство случаев дисплазии Книста возникает в результате новых мутаций гена и возникает в семьях, в которых это заболевание не было в анамнезе.

      Однако Книст может быть унаследован; состояние следует по аутосомно-доминантному типу. Это означает, что если один из родителей страдает дисплазией Книста, каждый из их детей имеет 50-процентный шанс унаследовать это заболевание.

      Симптомы дисплазии Kniest могут включать:

      • Короткие конечности
      • Укороченный ствол, из-за чего ребенок выглядит бочкообразным
      • Сколиоз
      • Дисплазия тазобедренного сустава, при которой два тазобедренных сустава смещены или искривлены
      • Опухшие, жесткие или деформированные суставы, препятствующие полному движению (особенно в коленях и локтях)
      • Хрупкий костный хрящ, ослабленный небольшими отверстиями, из-за чего хрящ на рентгеновских снимках выглядит как швейцарский сыр
      • Деформации стопы, в том числе косолапость
      • Круглое плоское лицо с выпуклыми или широко расставленными глазами
      • Расщелина неба, отверстие или щель в небе
      • Потеря слуха и проблемы со зрением
      • Паховая грыжа, при которой внутренний орган выпячивается через отверстие в брюшную полость
      • Респираторные проблемы

      Диагностическая оценка обычно начинается с тщательного изучения истории болезни и физического осмотра вашего ребенка.В детской больнице Филадельфии (CHOP) клинические эксперты используют различные диагностические тесты для диагностики дисплазии Книста и возможных осложнений, в том числе:

      • Рентгеновские снимки , дающие изображения костей.
      • Магнитно-резонансная томография (МРТ) , которая использует комбинацию больших магнитов, радиочастоты и компьютера для получения детальных изображений органов и структур внутри тела.
      • Компьютерная томография (КТ) , в которой используется комбинация рентгеновских лучей и компьютерных технологий для получения изображений поперечного сечения («срезов») тела.
      • Генетическое тестирование , в котором образец слюны или крови вашего ребенка используется для идентификации ДНК вашего ребенка.
      • EOS imaging — технология визуализации, которая создает трехмерные модели из двух плоских изображений. В отличие от компьютерной томографии, изображения EOS делаются, когда ребенок находится в вертикальном или стоячем положении, что позволяет улучшить диагностику благодаря положению с опорой на вес.

      Все эти медицинские тесты позволяют врачам собрать полную картину состояния здоровья вашего ребенка и помочь в составлении индивидуального плана ухода.

      В некоторых случаях дисплазию Книста можно заподозрить или диагностировать, когда ребенок еще находится в утробе матери. Пренатальные тесты, такие как амниоцентез и CVS, могут идентифицировать известные мутации Kniest; сонограмма в конце второго триместра может выявить некоторые костные аномалии. Для получения дополнительной информации о пренатальном тестировании на скелетную дисплазию см. Центр диагностики и лечения плода.

      Лечение дисплазии Книста является многосторонним, поскольку заболевание влияет на несколько систем организма.В некоторых случаях может потребоваться тщательный мониторинг. В других случаях может потребоваться нехирургическое или хирургическое лечение для лечения определенных аспектов состояния.

      В детской больнице Филадельфии мы практикуем коллективную помощь, ориентированную на семью. Команда опытных клиницистов, в которую входят ведущие хирурги и врачи, детские медсестры, физиотерапевты и эрготерапевты, психологи и другие специалисты, будут сотрудничать с вами в уходе за вашим ребенком.

      Многим детям с дисплазией Книста также диагностируют различные ортопедические заболевания, включая сколиоз, дисплазию тазобедренного сустава, жесткость суставов, черепно-лицевые аномалии и укорочение конечностей.В некоторых случаях эти состояния присутствуют при рождении и поддаются лечению, когда ребенок маленький.

      Например, ребенку с расщелиной неба или косолапостью потребуется операция; в то время как ребенок с небольшой потерей слуха может нуждаться только под наблюдением, чтобы убедиться, что его состояние не ухудшается. Специалисты-ортопеды из наших программ по лечению заболеваний рук и кистей, программ ног и стоп и аудиологии будут работать с вашей семьей, чтобы разработать индивидуальный план ухода за вашим ребенком.

      В других случаях осложнение дисплазии Кнаста может стать очевидным — или проблематичным — только по мере роста вашего ребенка.Это часто верно в отношении деформаций позвоночника, таких как сколиоз, заболевания бедра, коленные осложнения и жесткость суставов.

      В зависимости от потребностей вашего ребенка специалисты-ортопеды из нашей программы лечения позвоночника, нашей программы лечения заболеваний тазобедренного сустава и / или нашей программы ног и стоп будут лечить вашего ребенка.

      Состояние каждого ребенка индивидуально, поэтому лечение подбирается индивидуально. Например, если у вашего ребенка сколиоз, наша команда специалистов рассмотрит степень тяжести искривления позвоночника, а также возраст и стадию роста вашего ребенка, прежде чем определить наилучший курс действий.

      Лечение может включать нехирургические варианты, такие как фиксация и физиотерапия, или хирургические варианты, такие как спондилодез или имплантация растущих стержней для стабилизации позвоночника вашего ребенка, когда он продолжает расти.

      Ваш ребенок с дисплазией Книста должен и в зрелом возрасте находиться под наблюдением врача-ортопеда.

      Если вашему ребенку была сделана операция на позвоночнике, ему или ей необходимо будет обратиться к хирургу-ортопеду через 1-2 недели после операции, а затем снова через три и шесть месяцев после операции.После этого настоятельно рекомендуется проводить ежегодный мониторинг со стороны обученных врачей, чтобы гарантировать, что любые проблемы будут обнаружены и устранены как можно скорее.

      Кроме того, врачи могут порекомендовать вашему ребенку обратиться к нескольким различным специалистам, поскольку дисплазия Книста может затронуть другие системы организма.

      Например, ваш ребенок может видеть:

      • Ортопед по вопросам, связанным с костями, мышцами и суставами
      • Пластический хирург по поводу черепно-лицевых аномалий или аномалий кисти
      • Сурдолог по вопросам слуха
      • Врач-офтальмолог по проблемам зрения
      • Физиотерапевты и эрготерапевты для развития физических способностей и навыков вашего ребенка

      Во время контрольных визитов могут быть сделаны рентгеновские снимки и другие диагностические исследования.Целью постоянного мониторинга является выявление любых нарушений в росте или развитии и решение проблем со здоровьем по мере их появления.

      Последующее наблюдение, постоянная поддержка и услуги доступны в нашем основном кампусе и во всей сети CHOP Care Network. Наша команда стремится сотрудничать с вами и направлять врачей, чтобы обеспечить вашему ребенку наиболее актуальную, всестороннюю и специализированную помощь.

      Дети с дисплазией Книста могут вести относительно нормальную жизнь.У них нормальный интеллект и нормальная продолжительность жизни. Они могут иметь хорошую работу, жениться, иметь детей и многое другое.

      Люди с дисплазией Книста могут заболеть артритом на ранней стадии из-за аномалий суставов и могут быть не в состоянии участвовать в определенных видах деятельности.

      Если у вас есть вопросы о том, как состояние вашего ребенка и любые связанные с ним проблемы со здоровьем могут повлиять на прогноз или долгосрочные цели вашего ребенка, поговорите с лечащим врачом вашего ребенка.

      Врожденная спондилоэпифизарная дисплазия | Johns Hopkins Medicine

      Что такое врожденная спондилоэпифизарная дисплазия?

      Врожденная спондилоэпифизная дисплазия — редкое генетическое заболевание, которое включает увеличение позвоночника и эпифиза (увеличение области на конце длинных костей).Классифицируется как дефект коллагена 2 типа, он влияет на структуру соединительной ткани (коллагена), которая поддерживает многие части тела.

      Врожденная спондилоэпифизная дисплазия может быть унаследована с аутосомно-доминантным геном, что означает, что один родитель передает ген ребенку. Но многие пациенты заболевают из-за новой мутации или нового изменения гена.

      Каковы симптомы врожденной спондилоэпифизарной дисплазии?

      • Высота обычно 35.От 5 до 49 дюймов
      • Короткое туловище и конечности
      • Маленькая горловина
      • Сколиоз (искривление позвоночника) и кифоз (округление позвоночника), обычно развивающиеся до подросткового возраста
      • Распространенная боль в спине
      • Варус бедра — угол наклона концов костей вовнутрь — приводящий к контрактурам бедра
      • Варус или преклонение колен
      • Опоры Equiovarus (повернутые вниз и вниз)
      • Проблемы с шеей (общие) из-за неполного или недоразвитого позвонка
      • Проблемы с дыханием у младенцев из-за маленькой грудной клетки
      • Проблемы со зрением (общие), например отслоение сетчатки
      • Преждевременный артрит бедра

      Диагностика конгенитовой спондилоэпифизарной дисплазии

      Врач ставит диагноз врожденной спондилоэпифизарной дисплазии на основании полной истории болезни, физического осмотра, тщательного неврологического осмотра и диагностических тестов.

      Диагностические процедуры могут включать:

      • Рентгеновские снимки шеи, позвоночника, нижних конечностей и таза
      • МРТ спинного мозга для определения сдавления спинного мозга
      • Артрограммы, во время которых в бедра вводят краситель для оценки хряща

      Лечение конгенитовой спондилоэпифизарной дисплазии

      Лечение врожденной спондилоэпифизарной дисплазии варьируется в зависимости от сопутствующих ортопедических состояний и может включать:

      • Спондилодез и возможная декомпрессия шейного отдела позвоночника (шеи) — может потребоваться нимб и жилет
      • Коррекция сколиоза и кифоза при раннем выявлении
      • Спондилодез при сколиозе и кифозе
      • Остеотомия бедра для исправления смещения и / или подвывиха (частичный вывих и контрактуры сгибания бедра)
      • Отливка при деформациях стопы
      • Полная замена суставов по индивидуальному заказу
      Коррекция сколиоза