Дизентерия вакцинация: Прививка от дизентерии зонне Шигеллвак в клинике МедиАрт / ЗАО Москвы

Содержание

Прививка от дизентерии зонне Шигеллвак в клинике МедиАрт / ЗАО Москвы

Вакцинация от дизентерии

Дизентерия – это распространённая кишечная инфекция. На долю дизентерии приходится 70% всех случаев желудочно-кишечных заболеваний. Возбудителем заболевания являются бактерии рода шигелл, наиболее часто – Шигеллы Зонне (не менее 80% тех случаев, когда возбудитель устанавливался лабораторно). Вспышка в детсадах и школах Москвы в 2018-2019 годах, когда заболело множество детей в школах и детских садах, была вызвана именно возбудителем дизентерии — Шигеллой.

Возбудитель попадает в организм через пищу. При этом он хорошо размножается в молоке и молочных продуктах. Всего десяти бактерий, попавших в организм человека, достаточно для того, чтобы развились клинические проявления заболевания: диарея, лихорадка, тошнота, примесь крови в каловых массах. Они проявляются через несколько дней после потребления заражённых пищевых продуктов или воды и могут держаться в течение нескольких дней или недель.

Больной с легкой формой дизентерии может пройти лечение амбулаторно, однако чаще всего при этом заболевании требуется стационарная терапия, которая предполагает постельный режим, прием антибиотиков и диетическое питание. Дизентерия обладает одной существенной особенностью – бактерии быстро приобретают устойчивость к антибиотикам, поэтому лечение в некоторых случаях может затянуться надолго.

Основная опасность – это интоксикация и обезвоживание. Маловероятно, что от дизентерии наступит смерть. Но в крайне тяжелой степени, когда наблюдается стул с кровью и слизью по 50 раз в день, больные даже могут погибнуть.

Вакцинация от дизентерии Зонне

Прививка от дизентерии взрослым и детям является наиболее эффективной профилактической мерой, позволяющей сформировать иммунитет на 12 месяцев. Её делают весной и осенью перед пиками заболеваемости, характерными для сезонов, когда появляются свежие овощи.

Вакцинация против дизентерии Зонне позволит вам почувствовать себя более защищёнными и снизит риск возникновения заболевания.

Кому необходимо сделать прививку от дизентерии Зонне?

  • Детям старше 3 лет, которые посещают детские учреждения (детский сад, школу, колледж).

  • Детям отправляющимся в оздоровительный лагерь.

  • Сотрудникам инфекционного стационара или биологической лаборатории.

  • Работникам сферы общепита или коммунального благоустройства.

  • Выезжающим в регионы и страны, где менее развита гигиеническая культура или отсутствуют условия для соблюдения правил гигиены.

Сделав перед поездкой прививку Вы будете в большей уверенности, что вы и ваш ребенок действительно отдохнёте, а не столкнётся с кишечным заболеванием.

Когда вакцинация противопоказана?

  • При острых заболеваниях и обострении хронических
  • Женщинам во время беременности, а также в период кормления грудью
  • В случае возможной аллергической реакции на компоненты прививки

Как проходит вакцинация?

Вакцинации выполняется глубоко подкожно или внутримышечно в наружную треть плеча препаратом Шигеллвак (липополисахаридная вакцина из штамма Зонне). Иммунитет против возбудителя дизентерии вырабатывается уже на 14-20 день после прививки и обеспечивает невосприимчивость к инфекции в течение 1 года. Прививку можно сделать детям старше 3х лет и взрослым. Для многолетней защиты необходимо проведение ревакцинации каждый год той же дозой препарата.

Записывайтесь на вакцинацию «Шигеллвак» в клинику «МедиАрт» по телефону.

Шигеллвак — вакцинация против дизентерии Зонне

Шигеллвак

В клиниках АО «Семейный доктор Вы можете пройти вакцинацию против дизентерии Зонне современной отечественной вакциной «Шигеллвак».

Дизентерия – это распространённая кишечная инфекция. На долю дизентерии приходится 70% всех случаев желудочно-кишечных заболеваний. Заболеть могут и взрослые, и дети. Дети болеют чаще, поскольку хуже соблюдают правила гигиены. Дизентерию не случайно называют «болезнью грязных рук», – возбудитель передаётся оральным путём, то есть попадает в организм через пищу. При этом он хорошо размножается в молоке и молочных продуктах. Поэтому даже личная гигиена не устраняет риск заражения полностью. Вспышки дизентерии нередко возникают в детских коллективах (в детских садах). В связи с этим пик заболеваемости сдвинулся с лета (тёплые дни способствуют активности инфекции) на осенний период.

Возбудителем заболевания являются бактерии рода шигелл, наиболее часто – шигеллы Зонне (не менее 80% тех случаев, когда возбудитель устанавливался лабораторно). Вакцинация против дизентерии Зонне позволит вам почувствовать себя более защищёнными и снизит риск возникновения заболевания. В некоторых случаях вакцинация особенно актуальна.

Сделать прививку от дизентерии Зонне необходимо, если вы:  

  • работник инфекционного стационара или биологической лаборатории;

  • работаете в сфере общественного питания или коммунального благоустройства;  

  • выезжаете в регион, где менее развита гигиеническая культура или отсутствуют условия для соблюдения правил гигиены. Особенно, если вы планируете выезд в тёплое время года.

  • Детям, которые посещают  детские учреждения или отправляются в оздоровительный лагерь, также весьма желательно сделать эту прививку. Вы будете в большей уверенности, что ваш ребенок действительно отдохнёт, а не столкнётся с кишечным заболеванием.

Вакцина «Шигеллвак» производится российской компанией ООО «Гритвак». Вакцина зарегистрирована в 2008 году и прошла все необходимые клинические испытания. На сегодняшний день «Шигеллвак» является одной из самых эффективных вакцин для профилактики дизентерии.

Иммунитет против возбудителя дизентерии вырабатывается уже на 14-20 день после прививки и обеспечивает невосприимчивость к инфекции в течение 1 года.  Прививка возможна как взрослым, так и детям от 3-х лет. Вакцинацию можно проводить ежегодно.

Сделать прививку вакциной «Шигеллвак» вы можете в любой из клиник «Семейного доктора». 

Уважаемые пациенты! Обращаем Ваше внимание, что предвакцинальный и поствакцинальный осмотры пациента врачом-терапевтом/педиатром оплачиваются отдельно. Цену услуги Вы можете уточнить ниже.

Прививки (вакцинация) от дизентерии сделать в СПб (для взрослых и детей)

Дизентерия (медицинское название «шигеллёз») — это острая инфекция, возбудителем которой являются специфические бактерии — шигеллы. Эта болезнь может привести к тяжелейшим осложнениям вплоть до летального исхода. При этом существующие медицинские препараты для лечения не всегда могут уберечь больного от последствий. Правильным решением будет сделать прививку от дизентерии в СПб.

Как предотвратить заражение? 

Наряду со стандартными способами предотвращения заражения (регулярным мытьём рук, обработкой продуктов питания и пр.), в качестве профилактической меры свою эффективность показывает вакцинация от дизентерии для взрослых и детей. В медицинском центре «СМ-Клиника» для этого применяется вакцина «Шигеллвак».

После введения сыворотки у вакцинированного начинают вырабатываться специфические антитела, препятствующие заражению дизентерией. Иммунитет к инфекции формируется примерно через две недели. Эффект от вакцины действует около года.

Показания к прививкам от дизентерии

Профилактическая вакцинация против дизентерии может быть проведена не только взрослым, но и детям от 3 лет. Препарат выпускается в двух дозировках: 0,25 и 0,5 мл. При необходимости препарат может быть введён повторно.

Особенно прививание необходимо:

  • работникам общепита;
  • детям, которые посещают детсад и школу, а также выезжающим в летний лагерь;
  • людям, планирующим поездку в регионы с повышенной вероятностью заражения.

Наши клиники в Санкт-Петербурге

Малая Балканская, д. 23 (м. Купчино)

Часы работы:

Ежедневно
с 9.00 до 22.00

Дунайский проспект, д. 47 (м. Дунайская)

Часы работы:

Ежедневно
с 9.00 до 22.00

Проспект Ударников, д. 19 корп. 1 (м. Ладожская)

Часы работы:

Ежедневно
с 9.00 до 22.00

Выборгское ш., д. 17 корп. 1 (м. Пр-т Просвещения)

Часы работы:

Ежедневно
с 9.00 до 22.00

Маршала Захарова, д. 20 (м. Ленинский пр-т)

Часы работы:

Ежедневно
с 9.00 до 22.00

Противопоказания к прививкам против дизентерии

Как и любое лекарственное средство, вакцинация против дизентерии имеет некоторые противопоказания. Основное — индивидуальная непереносимость компонентов препарата. Чтобы исключить приступ аллергии пациенту сначала вводится небольшая доза препарата, и врач наблюдает за самочувствием вакцинированного.

Также прививки против дизентерии не рекомендуются:

  • беременным;
  • детям до 3 лет;
  • людям, в период обострения хронических заболеваний;
  • пациентам с острой инфекцией.

Как проводится вакцинация от дизентерии?

Введение препарата проводится строго в условиях процедурного кабинета. Открытие ампулы должно проходить в полной стерильности. Укол ставится подкожно в область плеча.

Перед тем, как сделать вакцинацию от дизентерии, врач проведёт обследование, чтобы исключить возможные медицинские противопоказания. Решение о возможности введения препарата принимается на основе осмотра, а также результатов лабораторных исследований крови и мочи.

После укола пациенту рекомендовано около часа находиться в клинике, чтобы врач мог проследить за реакцией организма.

Цены на прививки от дизентерии

Прививочный кабинет — Процедурный кабинет — Дневной (хирургический) стационар — Отделения

Прививочный кабинет

Прививка против дизентерии

ШИГЕЛЛВАК – отечественная вакцина для профилактики дизентерии Зонне у взрослых и детей в возрасте от трех лет. 

Профилактические прививки против дизентерии Зонне предпочтительно проводить перед сезонным подъемом этой инфекции.

Прививку производят однократно, внутримышечно.

Введение вакцины приводит к быстрому и интенсивному нарастанию в крови вакцинированных специфических антител, обеспечивающих через 2-3 недели невосприимчивость к инфекции в течение 1 года.

По эпидемическим показаниям прививки проводят при угрозе возникновения эпидемии или вспышки (стихийные бедствия, крупные аварии на водопроводной и канализационной сети), а также в период эпидемии, при этом в угрожаемом районе проводят массовую иммунизацию населения.

Прививка против дизентерии проводится у:

  • детей, посещающих детские учреждения и отъезжающих в оздоровительные лагеря;
  • лиц, занятых в сфере общественного питания и коммунального благоустройства;
  • лиц, отъезжающих в регионы с высоким уровнем заболеваемости дизентерией Зонне.
  • работников инфекционных стационаров и бактериологических лабораторий.

Прививка против брюшного тифа

ВИАНВАК   отечественная вакцина для профилактики брюшного тифа у взрослых.

Невосприимчивость к инфекции сохраняется в течение 2-х лет.

Ревакцинация проводится через каждые 2 года.

Вводится однократно, подкожно в наружную поверхность верхней трети плеча.

Прививка против гепатита А

ХАВРИКС – инактивированная вакцина для профилактики гепатита А.

Вакцина Хаврикс обеспечивает защиту против гепатита А, формируя специфический иммунитет путем индукции выработки антител против вируса гепатита А, а также активации клеточных механизмов иммунитета.

Показана для проведения активной иммунизации лиц с повышенным риском развития гепатита А. Двукратная вакцинация, с интервалом 6-12 мес. обеспечивают защиту от клинически манифестных форм гепатита А на период не менее, чем 20 лет.

Прививки производят внутримышечно.

Прейскурант прививочного кабинета:

1-я вакцинация против гепатита А (Хаврикс) 3 002 p.
1-я вакцинация против дифтерии и столбняка 850 p.
2-я вакцинация против гепатита А (Хаврикс) 3 002 p.
2-я вакцинация против дифтерии и столбняка 893 p.
Вакцинация против брюшного тифа (Вианвак) 1 472 p.
Вакцинация против клещевого энцефалита 857 p.
Введение АДМ или АДСМ 1 064 р.
Введение стафилококкового анатоксина 491 p.
Введение столбнячного анатоксина 768 p.
Введ.иммуноглобулина человеч.донорского 410 p.
Введ.противостолбн.челов.иммуноглобулин. 2 782 p.
Гонококковая вакцинация 391 p.
Лечение герпетической вакциной (без ст-ти лекарств) 1 введение 715 p.
Прививка от вирусного гепатита В 901 p.
Прививка от дизентерии (Шигеллвак) 1 666 p.
Прививка от кори 638 p.
Прививка против краснухи 727 p.
Противогриппозная вакцинация 1 064 р.

Вакцинация от дизентерии

Вся правда о вакцинации: наша цель не что-либо доказать, не навязать, а изложить лишь факты:

  • продолжительность жизни увеличилась благодаря вакцинации на десятки лет
  • благодаря прививкам мы не видим эпидемии оспы, полиомиелита, дифтерии, кори
  • но корь в наше время есть, за счет увеличения «прослойки» невакцинированных
  • инфекционные болезни не так страшны для людей, как раньше

Перестав бояться болезней, люди стали боятся прививок!

Появилось АНТИПРИВИВОЧНОЕ ДВИЖЕНИЕ, которое подпитывается видеострашилками в интернете.

РЕЗУЛЬТАТ:

  • Отказ от вакцинации — угроза здоровью своих детей на протяжении всей жизни
  • перенос вакцинации на более поздние сроки — угроза здоровью, а иногда и жизни ребенка в младенчестве
  • Снижение коллективного иммунитета и появление случаев управляемых инфекций (как, анпример, сейчас — корь)

Мнение некоторых родителей: прививка – «садит» иммунитет.

ФАКТ: Иммунный ответ на прививку в целом такой же, как и на любой инфекционный  агент, только с тем отличием, что антиген ослабленный или убитый!  Это как «подобие»  микроба. Вакцинный антиген не способен причинить  вред организму!

Заблуждение: «грудное молоко — всё убивает».

ФАКТ: Несомненно, что грудное молоко содержит большое количество биоактивных факторов, которые способствуют  здоровому развитию. Да! Груднички болеют реже. Но БОЛЕЮТ, особенно недоношенные!

Позиция антивакцинаторов:  вред  прививок  состоит  во вмешательстве  в эволюционный  процесс. То есть,  пусть иммунная систем сама разбирается.  Основной признак эволюции   – «выживает сильнейший». 

 Мы против селекционного подхода!

«ДОРОГ КАЖДЫЙ РЕБЕНОК»  – так  написано в Конвенции о  правах ребенка и это наша позиция.
Задайте  себе вопрос: « Готовы вы пожертвовать своими  детьми ради беспрепятственной работы  эволюции?»

«Пусть  иммунитет  сам работает» — говорят антипрививочники.

ФАКТ: Для развития имунной системы достаточно болеть  легкими ОРВИ  и не обязательно болеть, рискуя жизнью,  например,  переносить корь, дифтерию, грипп … 

Страхи родителей: «В вакцинах много  вредных примесей».

ФАКТ: В вакцине кроме прививочного агента, действительно, есть целый ряд других веществ. Они обеспечивают стабильность вакцины, некоторые работают  как усилитель  иммунного ответа. Эти соединения добавлены в вакцину не с целью принести вред ребенку! Цель – обеспечить безопасность вакцинации! 

«Но ведь ртуть токсична?» 

ФАКТ: Безусловно! Но ничтожные количества  ртути, которые содержаться в вакцинах, вреда здоровью причинить не могут!   Все зависит  от дозы!  «В ложке — лекарство, в чашке — яд» – слова  Парацельса. 

«Никто в мире столько вакцин не ставит»

ФАКТ: Ставят. Даже  еще  больше, чем в  нашем Национальном календаре!  

«Вакцины не имеют эффекта,  это производители  зарабатывают деньги» 

ФАКТ: Следуя этой логике, легче и проще  производить лекарства.  Чем больше больных — тем  лучше.  

«А осложнения?»  

ФАКТ: Дорогие родители! Не  все события, наблюдаемые после  прививки, являются следствием  вакцинации! Вакцины — не единственный фактор, влияющий негативно на здоровье. Существует много  всего: генетика,  плохая экология, неправильное  питание  и т.п.   

Прививка от дизентерии Зонне (шигелез)

Проводим вакцинацию от дизентерии Зонне (шигелеза). Безопасно, быстро, в 8 районах Санкт-Петербурга.

К сожалению, даже в наши дни такая болезнь как дизентерия весьма актуальна. Обезопасить себя и своих близких можно, сделав вакцинацию от шигелезза.

Прививка особенно актуальна для работников общепита, сотрудников коммунальной сферы, граждан, работающих в инфекционных медицинских учреждениях или лабораториях, а также для тех, кто уезжает в регион, с повышенным порогом заболеваемости.

Что такое дизентерия

Дизентерия Зонне – наиболее распространенная форма острой кишечной инфекции. Ее также называют «болезнью грязных рук». Даже тщательное соблюдение гигиены не может на 100% обезопасить человека. Подхватить инфекцию можно случайно через зараженную воду или вымытые ею продукты.

Первые симптомы могут появиться через два-три часа, но возможен и более длительный инкубационный период – от двух до трех дней. У больного наблюдается резкое повышение температуры, слабость, головная боль, боль в животе, рвота, диарея.

Если у человека хороший иммунитет, то процесс выздоровления займет от недели до 10 дней. После перенесенной болезни у организма появляется иммунитет к инфекции, но держится он недолго, всего несколько месяцев. Это означает, что существует риск повторного заболевания.

Больной с легкой формой дизентерии может пройти лечение амбулаторно, однако чаще всего при этом заболевании требуется стационарная терапия, которая предполагает постельный режим, прием антибиотиков и диетическое питание. В самых тяжелых случаях инфекции возможен летальный исход.

Вакцинация от дизентерии Зонне

Вакцинация – это способ защитить организм от болезни, с помощью искусственно созданного иммунитета к инфекционным и бактериальным возбудителям.

Если говорить проще, то прививка тренирует организм человека к возможной атаке вируса, запуская естественную иммунную реакцию. Это позволяет не допустить тяжелого течения болезни и возможных осложнений.

В каких случаях противопоказана вакцинация 

• Прививка не назначается детям до трех лет
• Женщинам во время беременности, а также в период кормления грудью
• В случае возможной аллергической реакции на компоненты прививки 
• При хронических заболеваниях или после недавно перенесенной болезни

Во всех случаях требуется консультация специалиста.

Побочная реакция

Процедура переносится безболезненно и чаще всего не имеет побочных эффектов. В очень редких случаях возможна реакция организма на прививку, которая проявляется в повышении температуры, головной боли, покраснении кожи и легкой аллергической реакции в виде небольшой сыпи. Симптомы незначительны и быстро проходят.

Где можно сделать прививку от дизентерии Зонне (шигеллеза)

Получить вакцинацию быстро и без риска для здоровья вы можете в одном из центров сети «Медкомиссия №1». Наши филиалы расположены в 8 районах Санкт-Петербурга и оборудованы новейшими высокотехнологичными лабораториями. Работают только сертифицированные специалисты.

Оформление прививочных сертификатов >>>

Узнать подробную информацию о прививке и записаться на прием можно по телефону +7 (812) 380-82-54

 

В Ялте начали вакцинацию работников общепита и торговли от дизентерии и гепатита А — Общество

ЯЛТА, 23 июня. /ТАСС/. Вакцинация сотрудников предприятий общепита и торговли от инфекционных заболеваний в Ялте должна быть усилена в связи подтоплениями города. Как сообщила в среду на заседании комиссии по ЧС в Ялте руководитель межрегионального управления Роспотребнадзора по Крыму и Севастополю Наталья Пеньковская, в городе начали прививать работников от дизентерии и гепатита А.

«Больница ФМБА (Федерального медико-биологического агентства) начала проведение иммунизации против дизентерии и гепатита А. Прежде всего этой иммунизации подлежат сотрудники, занятые в общепите и торговле. Таким образом, мы будем понимать, что очаги заражения в этих учреждениях у нас купированы. Для этого сотрудники у нас должны быть привиты против гепатита А, дизентерии и естественно COVID-19. Исходя из этой ситуации, эту работу надо разворачивать очень оперативно», — сказала Пеньковская.

В больнице ФМБА созданы прививочные бригады. Обращаясь к властям Ялты, Пеньковская указала на необходимость проработать вопрос организации вакцинации с представителями бизнеса. Она добавила, что в регионе решен вопрос по поставке недостающего количества вакцин от инфекционных заболеваний и бактериофага. В четверг они поступят на территорию Крыма.

Руководитель управления Роспотребнадзора также отметила, что в Ялте только пять инфекционных коек, на которых может оказываться помощь нековидным пациентам. В случае если в городе будет большое количество пациентов с инфекциями, их придется доставлять в Симферополь и Алушту.

Также руководитель управления Роспотребнадзора отметила, что на подтопленных территориях запаздывают с проведением дезинфекции улиц. «Прошу особого поручения оперштаба отрегулировать вопрос ежедневного — сразу после расчистки — проведения дезинфекции не только помещений, но и площадей, улиц, расчищенных территорий силами министерства обороны, у них есть соответствующие силы и средства, и, если готовы подключиться, то МЧС, — сказала Пеньковская. — Сотрудники Роспотребнадзора готовы участвовать в этой работе, проводить ежедневно с коллегами эту маршрутизацию по проведению работы. К этому надо приступать сейчас и делать это каждый день поэтапно».

Живая оральная вакцина против Shigella Dysenteriae

Скачать аннотацию (PDF — 0,76 МБ)

Краткое описание технологий

Shigella ежегодно вызывает миллионы случаев дизентерии, что приводит к 700 000 смертей во всем мире. Shigella dysenteriae серотипа 1, один из примерно сорока серотипов Shigella , вызывает более тяжелое заболевание с гораздо более высоким уровнем смертности, чем другие серотипы.Лицензированных вакцин для защиты от Shigella не существует. Тот факт, что многие изоляты проявляют множественную устойчивость к антибиотикам, усложняет лечение дизентерийных инфекций.

FDA Исследователи разработали конструкцию Salmonella typhi Ty21a, содержащую Shigella dysenteriae O-специфический полисахарид (O-Ps), вставленный в хромосому Salmonella typhi Ty21a, где гетерологичный Shigella-sergeydysenteriae устойчиво экспрессируется антигенотипом Shigella8 9000. вместе с гомологичным О-антигеном Salmonella typhi .Конструкции вызывают иммунную защиту против вирулентного заражения Shigella dysenteriae , а также заражения Salmonella typhi . Конструкция может быть использована в качестве нового кандидата на вакцину, стабильна для производства вакцины и обеспечивает комбинированную защиту от кишечной лихорадки, вызываемой Salmonella typhi и Salmonella sonnei .

Потенциальные коммерческие приложения Конкурентные преимущества
  • Один из компонентов разрабатываемой поливалентной противошигеллезной вакцины
  • Вакцины против шигеллы, терапевтические и диагностические средства
  • Оральная вакцина — иглы не требуются
  • Снижение себестоимости продукции
  • Низкозатратная вакцина
  • Температурно-стабильный производственный процесс — исключает необходимость охлаждения во время распространения вакцины

Стадия разработки: in vivo , исследования заражения мышей

Изобретатели: Деннис Копецко, Де Ци Сюй

Публикации:
«Связанная с ядром LPS-экспрессия О-антигена Shigella dysenteriae серотипа 1 в живом векторе Ty21a вакцины против Salmonella Typhi: доклинические доказательства иммуногенности и защиты.” Vaccine 2007 Aug; 25 (33): 6167-75 PMID: 17629369

Интеллектуальная собственность:
Патент США: 8,071,113, выдан 12.06.2011.
Патент США: 8,337,831, выдан 12.25.2012.
Патент США: 8,790,635, выдан 29.07.2014.
Патент США: 8,968,719, выдан 03.03.2015.
Патент США: 9,402,889, выдан 08.02.2016
Европейские патенты: 1756149, выдан 09.04.2013

Область продукта: Биопрепараты, вакцины

Номер ссылки FDA: E-2004-022

Контактное лицо по вопросам лицензирования:
Ken Millburne, J.D. Программа передачи технологий FDA
Эл. Почта: [email protected]
Телефон: 240-402-4315

  • Текущее содержание по состоянию на:

Дизентерия — NHS

Дизентерия — это инфекция кишечника, вызывающая диарею , содержащую кровь или слизь.

Другие симптомы дизентерии могут включать:

Дизентерия очень заразна и может передаваться, если вы не принимаете правильные меры предосторожности, такие как правильное и регулярное мытье рук.

Типы дизентерии

Существуют 2 основных типа дизентерии:

  • бактериальная дизентерия или шигеллез, вызываемый бактериями шигелл; это наиболее распространенный тип дизентерии в Великобритании.
  • амебная дизентерия или амебиаз, который вызывается амебой (одноклеточным паразитом) под названием Entamoeba histolytica, которая в основном встречается в тропических регионах; этот тип дизентерии обычно встречается за границей.

Лечение дизентерии

Поскольку дизентерия обычно проходит сама по себе через 3–7 дней, лечение обычно не требуется.

Однако важно пить много жидкости и при необходимости использовать растворы для пероральной регидратации, чтобы избежать обезвоживания.

Обезболивающие, такие как парацетамол, могут облегчить боль и жар. Избегайте лекарств от диареи, таких как лоперамид, потому что они могут усугубить ситуацию.

Вы должны оставаться дома не менее 48 часов после последнего приступа диареи, чтобы снизить риск передачи инфекции другим людям.

Как избежать передачи дизентерии

Мытье рук — самый важный способ остановить распространение инфекции.Вы заразны для других людей, когда болеете и у вас есть симптомы.

Примите следующие меры, чтобы не передать болезнь другим:

  • После посещения туалета тщательно вымойте руки водой с мылом. Узнайте больше о том, как мыть руки.
  • Не ходите на работу или в школу, пока вы полностью не избавитесь от каких-либо симптомов в течение как минимум 48 часов.
  • Помогите маленьким детям правильно мыть руки.
  • Не готовьте пищу для других, пока не избавитесь от симптомов в течение как минимум 48 часов.
  • Не ходите плавать, пока симптомы не исчезнут в течение как минимум 48 часов.
  • По возможности держитесь подальше от других людей, пока ваши симптомы не исчезнут.
  • Постирайте всю грязную одежду, постельное белье и полотенца в стиральной машине при максимальной температуре.
  • Вымойте сиденья и унитазы, ручки смыва, краны и раковины моющим средством и горячей водой после использования, а затем дезинфицирующим средством для дома.
  • Избегайте половых контактов, пока симптомы не исчезнут в течение как минимум 48 часов.

Поскольку шигелла легко передается другим людям, вам может потребоваться предоставить образцы фекалий (стула), чтобы вы могли вернуться на работу, в школу или детский сад.

Тип шигеллы, который у вас есть, и то, входите ли вы или другие люди в группу риска, повлияет на то, как долго вам нужно держаться подальше.

Группы риска — это люди с определенной работой (в том числе медицинские работники и люди, занимающиеся едой), а также люди, нуждающиеся в помощи с личной гигиеной, и очень маленькие дети. Ваш специалист по гигиене окружающей среды сможет сообщить вам об этом.

Когда обращаться к терапевту

Не всегда нужно обращаться к терапевту, если у вас дизентерия, потому что она обычно проходит в течение недели или около того.

Однако вам следует обратиться к терапевту, если ваши симптомы серьезны или они не начнут улучшаться через несколько дней. Сообщите им, если вы недавно были за границей.

Если у вас серьезные или стойкие симптомы, терапевт может назначить короткий курс антибиотиков. Если у вас очень тяжелая дизентерия, вам может потребоваться лечение в больнице на несколько дней.

Снижение риска заражения дизентерией

Вы можете снизить риск заражения дизентерией:

  • мыть руки теплой водой с мылом после посещения туалета и регулярно в течение дня
  • мыть руки перед тем, как брать в руки, есть или готовить продукты питания
  • избегать совместного использования полотенец
  • стирка белья инфицированного человека при максимально возможной температуре

Если вы путешествуете в страну, где высок риск заражения дизентерией, этот совет поможет предотвратить заражение:

  • Не пейте местную воду, если вы не уверены, что она чистая (стерильная) — пейте воду в бутылках или напитки в закрытых банках или бутылках.
  • Если вода нестерильная, прокипятите ее несколько минут или воспользуйтесь химическим дезинфицирующим средством или надежным фильтром.
  • Не чистите зубы водопроводной водой.
  • Не добавляйте лед в напитки, потому что он может быть сделан из нечистой воды.
  • Избегайте свежих фруктов и овощей, которые нельзя очистить от кожуры, прежде чем съесть их.
  • Избегайте еды и напитков, продаваемых уличными торговцами, за исключением напитков в должным образом закрытых банках или бутылках.

Узнайте больше о безопасности пищевых продуктов и воды за рубежом.

Что вызывает дизентерию?

Бациллярная и амебная дизентерия очень заразны и могут передаваться, если фекалии инфицированного человека попадают в рот другого человека.

Это может произойти, если инфицированный человек не моет руки после посещения туалета, а затем касается пищи, поверхностей или другого человека.

В Великобритании инфекция обычно поражает группы людей, находящихся в тесном контакте, например, в семьях, школах и детских садах.

Также существует вероятность заражения при анальном или анальном оральном сексе (римминг).

В развивающихся странах с плохой санитарией инфицированные фекалии могут загрязнять воду или продукты питания, особенно холодные сырые продукты.

Последняя проверка страницы: 6 января 2020 г.
Срок следующей проверки: 6 января 2023 г.

Почему одни вакцины не победят дизентерию

Поделиться
Артикул

Вы можете поделиться этой статьей с указанием авторства 4.0 Международная лицензия.

Несмотря на улучшение санитарии и доступа к чистой воде, дизентерия остается серьезным бременем для общественного здравоохранения, от которого чаще всего страдают дети в странах с низким уровнем доходов.

Новое исследование использует геномные методы, чтобы больше узнать о бактериях Shigella flexneri , которые являются основной причиной заболевания.

Исследователи секвенировали ДНК Shigella flexneri из образцов, взятых из Африки, Азии, Южной и Центральной Америки, а также образцов из исторических коллекций, датируемых 1913 годом.

Они обнаружили, что бактерии способны сохраняться в местной окружающей среде, что позволяет им колонизировать регионы в течение десятков или сотен лет.

Что еще более важно, работа также показала, что бактерии могут менять свой серотип — ключевую часть своего внешнего покрытия, которое «видит» иммунная система, что может сделать потенциальные вакцины бесполезными в борьбе с этим заболеванием.

«Понимание того, как S. flexneri изменилось и распространилось в эндемичных странах, жизненно важно для более эффективной разработки и целенаправленного вмешательства», — говорит руководитель исследования Томас Коннор из Школы биологических наук Кардиффского университета.

«Используя геномику, мы смогли однозначно охарактеризовать этот патоген в глобальном масштабе, и наши открытия переопределяют то, что мы знали об этой бактерии», — добавляет он.

Геномный анализ также показывает, что использование традиционных микробиологических методов, таких как серотипирование, для понимания распространения и разнообразия бактерий бесполезно для планирования кампаний общественного здравоохранения и создания эффективных вакцин.

«В отличие от других видов Shigella , мы обнаружили, что S.flexneri может выжить в географическом регионе, независимо от контакта с людьми. Это говорит нам о том, что уничтожение бактерий у людей с помощью одной лишь вакцинации, хотя и важно, этого недостаточно », — заявила Клэр Баркер, которая работала в группе Коннора над исследованием.

Выводы, полученные в результате секвенирования всего генома, также предлагают новые возможности для более целенаправленного производства вакцин.

«Наши результаты показывают, что основные линии S. flexneri способны переключаться между серотипами и тем самым избегать защитного эффекта серотипов вакцинации», — говорит профессор Ник Томсон, старший автор из Wellcome Trust Sanger Institute.

«Используя секвенирование генома для изучения видов с максимально возможным разрешением, мы можем идентифицировать четкие родословные бактерий на основе генов вирулентности, которые они несут.

«Эти линии затем могут быть более эффективно нацелены на вмешательство, будь то разработка вакцины и / или альтернативные стратегии», — добавляет он.

Результаты опубликованы в журнале eLife .

Источник: Кардиффский университет

Вакцины

Вакцинация против ротавируса необходима для предотвращения смерти от диареи у детей.

Ротавирус

Ротавирусные вакцины защищают от основной причины тяжелой детской диареи, и Всемирная организация здравоохранения рекомендует их внедрение во всех странах. В рамках интегрированного пакета вмешательств, который включает ПРС, цинк, грудное вскармливание, питание и воду, санитарию и гигиену, вакцинация против ротавируса является одним из лучших способов предотвратить смерть от диареи.

Ротавирус вызывает около одной трети детских смертей от диареи.Ежегодно во всем мире от ротавируса умирают около 200 000 детей в возрасте до 5 лет, и подавляющее большинство из них происходит в странах с низким уровнем доходов в Африке и Азии. Почти каждый ребенок в мире подвержен риску, независимо от его гигиены, санитарии или доступа к чистой воде. Ротавирусные инфекции нельзя лечить антибиотиками или другими лекарствами. Легкие ротавирусные инфекции можно эффективно лечить с помощью пероральной регидратационной терапии до тех пор, пока болезнь не пройдет, но детям с тяжелой ротавирусной диареей срочно требуется внутривенное введение жидкости, иначе они рискуют умереть от обезвоживания.В странах с низким уровнем доходов неотложная медицинская помощь этого типа часто недоступна или недоступна, что делает профилактику ротавирусной инфекции путем вакцинации критически важной для спасения жизни детей.

Ротавирусные инфекции происходят повсюду, но большинство смертей происходит в странах с низким уровнем доходов в Африке и Азии, где доступ к лечению ограничен.

Вакцины — лучший способ защитить детей от ротавируса и вызываемой им обезвоживающей диареи. Доступные во всем мире ротавирусные вакцины значительно улучшают здоровье и благополучие детей во всем мире за счет значительного сокращения случаев тяжелой диареи.Во многих странах, которые включили ротавирусные вакцины в свои национальные программы иммунизации, наблюдается быстрое и значительное снижение госпитализаций и смертности из-за ротавируса и других причин диареи. Вакцины также косвенно защищают тех, кто слишком молод или слишком стар для вакцинации через коллективный иммунитет. Несмотря на несколько недавних изменений на рынке ротавирусных вакцин, ротавирусные вакцины остаются рентабельными и не только улучшают здоровье детей, но и спасают жизни.

PATH обеспечивает доступ к ротавирусной вакцине всем детям, независимо от того, где они живут. Мы работаем со странами, чтобы помочь лицам, принимающим решения, оценить, оценить и подготовиться к внедрению ротавирусной вакцины и ее стоимости. Одновременно мы также поддерживаем разработку и лицензирование новых вариантов вакцин. Например, PATH поддержал разработку двух вакцин индийского производства: ROTAVAC®, которая стоит всего 1 доллар США за дозу, и ROTASIIL®, которая является термостойкой. Оба получили одобрение ВОЗ в 2018 году.Наконец, мы также сотрудничаем с производителями, чтобы ускорить разработку вакцин нового поколения против ротавируса.

Помогая странам сделать больше ротавирусных вакцин доступными для выбора, мы можем расширить доступ, улучшить предложение, сократить расходы и, в конечном итоге, спасти больше жизней от этой предотвратимой болезни.

Для ознакомления с картами внедрения ротавирусной вакцины в стране, информационными бюллетенями и другими полезными материалами посетите наш сборник информационных ресурсов по ротавирусной инфекции.

ETEC и Shigella

Энтеротоксигенные Escherichia coli (ETEC) и Shigella, основных причин бактериальной диареи, входят в пятерку основных патогенов, вызывающих умеренную и тяжелую диарею у детей в Африке и Южной Азии. Вакцины для защиты от ETEC и Shigella в настоящее время находятся в стадии разработки.

Вакцины ETEC и Shigella могут защитить от каскадного бремени болезней, вызываемых ведущими бактериальными возбудителями диареи.

Инфекции от Shigella , вызывающего дизентерию, и ETEC обычно вызываются зараженной пищей или водой. Болезнь может привести к обезвоживанию и недоеданию, а также к нарушению физического и умственного развития маленьких детей, вызывая каскадное бремя болезней с долгосрочными последствиями. В странах с низким уровнем ресурсов, где доступ к медицинской помощи часто ограничен, а неправильное использование антибиотиков усиливает бактериальные патогены, вакцины для предотвращения ETEC и Shigella обладают огромным потенциалом.

PATH сотрудничает с партнерами из частного и государственного секторов в разработке безопасных, эффективных и доступных вакцин против ETEC и Shigella , применяя ряд подходов для каждого патогена. Мы передали одну вакцину-кандидат от ETEC на позднюю стадию разработки, и несколько многообещающих кандидатов от Shigella добиваются прогресса. Мы также определили очень многообещающий компонент вакцины, который планируем протестировать с несколькими вакцинами-кандидатами. Наконец, чтобы гарантировать, что вакцины ETEC и Shigella будут доступны всем детям, которые в них нуждаются, мы оцениваем партнеров-производителей, в основном в развивающихся странах, с тем, чтобы они взяли на себя производство и распространение этих вакцин.

Присоединяйтесь к разговору, поделившись этим изображением в социальных сетях, используя хэштег #DefeatDD.

Фото предоставлено: PATH.

побочных эффектов вакцины против COVID-19 | Yale Health

Побочные эффекты вакцинации от COVID-19 могут ощущаться как грипп и даже влиять на вашу способность выполнять повседневные дела, но они должны исчезнуть через несколько дней.

Возможные побочные эффекты вакцины против COVID-19

Общие побочные эффекты включают:

  • Больная рука или боль и покраснение в месте инъекции
  • Увеличение лимфатических узлов в подмышечной области на той же стороне, что и место инъекции
  • озноб или лихорадка
  • Усталость, ломота в теле или ощущение усталости
  • головная боль
  • тошнота, рвота или диарея в первые 72 часа

Эти реакции часты и могут указывать на то, что ваш организм вырабатывает иммунный ответ на вакцину.Они должны исчезнуть в течение 1-2 дней, за исключением увеличения лимфатических узлов, которые могут сохраняться до 10 дней.

Советы, которые помогут вам выявить и минимизировать легкие побочные эффекты:

  • Прочтите информацию о вакцинах, прилагаемую к приглашению на планирование, чтобы освежить свои знания о побочных эффектах.

  • Используйте пакет со льдом или прохладную влажную ткань, чтобы уменьшить покраснение, болезненность и / или припухлость в месте, где была сделана инъекция.

  • Прохладная ванна также успокаивает.

  • Пейте много жидкости в течение 1-2 дней после вакцинации.

  • Если у вас нет особых противопоказаний, примите безрецептурное обезболивающее.

  • Средство проверки состояния здоровья после вакцинации Центра по контролю и профилактике заболеваний (CDC) — это инструмент на базе смартфона, который вы можете использовать, чтобы быстро сообщить CDC, если у вас есть какие-либо побочные эффекты. Участие является добровольным и не заменяет собой медицинское обслуживание.

Когда звонить на справочную службу по COVID в кампусе (CCRL)

Если ваши симптомы тяжелые или длятся более 72 часов, звоните по телефону 203-432-6604 (или 866-924-9253) с 8:30 до 17:00, 7 дней в неделю.

Когда вам, возможно, потребуется пройти обследование на инфекцию COVID-19

Хотя некоторые из общих побочных эффектов схожи с симптомами COVID-19, следующие симптомы указывают на инфекцию COVID-19 и не вызваны вакциной. Если вы испытываете какой-либо из этих симптомов:

  • Новая потеря запаха или вкуса
  • Кашель или одышка
  • Заложенность / боль в горле / насморк / конъюнктивит (красные глаза)
  • Тошнота / рвота или диарея, развивающиеся через 72 часа

Оставайтесь дома и позвоните своему провайдеру или в CCRL, чтобы назначить тест на COVID-19.

Johnson & Johnson, вакцина против COVID-19 Редкое и серьезное нежелательное явление

Редкое и серьезное нежелательное явление (образование тромбов с низким содержанием тромбоцитов) было связано с вакциной J&J. Это нежелательное явление очень редко встречается примерно у 7 на 1 миллион вакцинированных женщин в возрасте от 18 до 49 лет. В других популяциях этот показатель еще ниже. Женщины моложе 50 лет должны знать о редком, но повышенном риске этого нежелательного явления и о том, что существуют другие доступные варианты вакцины против COVID-19, для которых этот риск не выявлен.CDC и FDA будут продолжать следить за безопасностью всех вакцин против COVID-19.

Женщинам в возрасте от 18 до 49 лет, получившим вакцину J&J, рекомендуется следовать этому руководству:

Если вы получили вакцину J&J, помните о возможных симптомах тромба с низким содержанием тромбоцитов в течение трех недель после вакцинации. К ним относятся:

  • Сильные или постоянные головные боли или помутнение зрения
  • Одышка
  • Боль в груди
  • Отек ноги
  • Постоянные боли в животе
  • Легкие синяки или крошечные пятна крови под кожей за пределами места инъекции

Немедленно обратитесь за медицинской помощью, если у вас появится один или несколько из этих симптомов.

Невирулентный штамм Brachyspira hyodysenteriae вырабатывает кишечные IgA и замедляет распространение дизентерии свиней | Ветеринарные исследования

Эксперименты на животных были одобрены Этическим комитетом факультета ветеринарной медицины Гентского университета, Бельгия (EC 2012/01, EC 2013/147, EC2014 / 130, EC2015 / 22, EC2015 / 134) и соответствовали требованиям. все этические и хозяйственные нормы.

Brachyspira hyodysenteriae штаммы и условия роста

Три B.hyodysenteriae полевые штаммы и сильно гемолитический эталонный штамм B204 (ATCC32121) были использованы в экспериментальных испытаниях инфекций: слабо гемолитический штамм D28 и сильно гемолитический штамм 8dII — два полевых штамма, которые были описаны ранее [23]. Сильно гемолитический штамм 49 был выделен в этом исследовании от животных-сеялок, приобретенных у коммерческого источника, страдающего острой вспышкой SD. Штаммы и их сила гемолиза приведены в таблице 1. Сила гемолиза определялась как видимый гемолиз роста на культуральных чашках с добавлением крови и путем количественной оценки in vitro, как описано в предыдущем исследовании [23].

Таблица 1 Brachyspira hyodysenteriae Штаммы , экспериментальная установка и результаты по экскреции с фекалиями и клинические признаки SD

Для испытаний вирулентности штаммы были получены из замороженных запасов, разморожены и выращены на триптическом соевом агаре (BD, Гейдельберг, Германия) с добавлением 5% овечьей крови (IMP, Брюссель, Бельгия) и 1% дрожжевого экстракта (Oxoid, Aalst , Бельгия) [24].Штаммы дважды пересевали и получали суспензии, собирая 4-дневную культуральную пластину стерильным ватным тампоном и перемешивая ватный тампон в 50 мл анаэробного бульона для инфузии сердца мозга (BHI) с добавлением 10% фетальной бычьей сыворотки. (FBS). Бульон инкубировали в анаэробных условиях в течение 40 ч на качалке при 37 ° C. После инкубации культуры исследовали под микроскопом на чистоту, и каждому животному вводили 40 мл культуры B. hyodysenteriae , которая содержала приблизительно 1 × 10 8 колониеобразующих единиц на мл.Для испытания вакцинации сеялки культуры получали примерно так же, как и для испытаний на вирулентность, за исключением того, что бактерии выращивали в бульоне BHI с 10% FBS в течение 30 часов, после чего бульон анаэробов центрифугировали при 1500 g в течение 20 минут. и осадок суспендировали в объеме, приводящем к конечной концентрации приблизительно 1 × 10 9 B. hyodysenteriae на мл.

Испытания вирулентности

Для определения вирулентности in vivo различных B.hyodysenteriae , было проведено несколько экспериментальных исследований инфекции. Корреляция между выделением фекалий как показателем кишечной колонизации и показателем фекалий как показателем развития SD была определена независимо для четырех различных штаммов B. hyodysenteriae в пяти экспериментальных испытаниях инфекций. Эксперименты проводились отдельно в разные периоды времени. В каждом эксперименте использовался один штамм. Штамм D28 использовали в двух независимых экспериментах.

Экспериментальная установка Пять экспериментальных установок представлены в таблице 1. Во всех установках экспериментальные животные были приобретены из коммерческих источников без предшествующей истории болезни SD. По прибытии фекалии были собраны у всех животных и исследованы на наличие Salmonella sp. с помощью микробной культуры, как описано ранее [25], и на наличие B. hyodysenteriae с помощью микробной культуры и количественной ПЦР [26].Все животные получали коммерческий стартовый корм ad libitum.

Экспериментальные процедуры Инокуляцию проводили в течение трех дней подряд, и ей предшествовало 12-часовое голодание. Инокуляцию проводили перорально или внутрижелудочно, как указано в таблице 1. Для внутрижелудочной инокуляции животных анестезировали внутримышечной инъекцией комбинации ксилазина в дозе 4,4 мг / кг (Xyl-M 2% ® , VMD, Arendonk, Бельгия) и золазепама. / тилетамин по 2.2 мг / кг (Золетил ® 100, Вирбак, Карро, Франция). Всех животных, которым вводили внутрижелудочную вакцинацию, предварительно обрабатывали за 90 мин до инокуляции ранитидином в дозе 0,75 мг / кг (Zantac ™, GlaxoSmithKline, Genval, Бельгия) для снижения продукции кислоты в желудке.

В эксперименте 3 вместо прямого инокуляции контактных животных (приемников) помещали в один блок с животными, которые выделяли B. hyodysenteriae и были подтверждены SD (сеялки). Эти животные-сеялки были приобретены у коммерческого источника, страдающего острой вспышкой SD.Штамм 49 был выделен из образцов фекалий этих свиней.

Последующее наблюдение Во всех испытаниях животных ежедневно наблюдали на наличие диареи и других признаков болезни. Два-три раза в неделю анализировали фекалии и собирали образцы стула. Оценка фекалий была определена как 0: нормальный, 1: более мягкий, но сформированный, 2: несформированный, полувлажный, 3: жидкий, 4: жидкий со слизью и кровью. К баллам 2 и 3 добавляли 0,5, если присутствовали кровь или слизь.ДНК экстрагировали из образцов стула с помощью набора Qiagen Stool Mini Kit (Qiagen, Hilden, Германия), и экстрагированную ДНК использовали для определения количества ДНК B. hyodysenteriae с помощью кПЦР [26]. Корреляция между фекальной экскрецией штамма, использованного для инокуляции, и фекальной оценкой определялась для каждого эксперимента.

В конце испытания (3-5 недель после инокуляции) или через 24 часа (испытание 2) после первых признаков дизентерии свиней животных умерщвляли. Во время аутопсии образцы ткани верхушки толстой кишки собирали в 10% забуференном формалине для гистологии во время аутопсии.Животных анестезировали комбинацией ксилазина в дозе 4,4 мг / кг (Xyl-M 2% ® , VMD, Arendonk, Бельгия) и золазепама / тилетамина в дозе 2,2 мг / кг (Zoletil ® 100, Virbac, Carros, Франция. ). Их усыпили путем введения передозировки пентобарбитала (Release ® , 45 мг / кг; Ecuphar, Oostkamp, ​​Бельгия) путем внутрикардиальной инъекции. Фиксированные образцы заливали парафином, делали срезы толщиной 5–8 мкм и окрашивали гематоксилином и эозином или периодическим кислотным реактивом Шиффа (PAS).

Испытания вакцинации

В испытании вакцинации сеялок невирулентный штамм D28 B. hyodysenteriae использовался в качестве иммунизирующего штамма, а вирулентный штамм B204 B. hyodysenteriae в качестве контрольного штамма. Шестьдесят 6-недельных поросят мужского и женского пола были приобретены у коммерческого источника, ранее не имевшего SD. По прибытии животные были взвешены и случайным образом разделены на шесть групп; три группы иммунизации (по 10 животных в каждой) и три группы без иммунизации (по 10 животных в каждой).Отдельные пробы фекалий были взяты для подтверждения отсутствия B. hyodysenteriae с помощью микробной культуры и количественной ПЦР. Все животные получали коммерческий стартовый корм ad libitum.

После 9-дневного периода акклиматизации животным в группах иммунизации перорально инокулировали, как описано для испытаний вирулентности, в течение трех последовательных дней (день -2, день -1, день 0) 20 мл культуры, содержащей приблизительно 10 9 колониеобразующих единиц (КОЕ) / мл невирулентного штамма D28.Соответственно, животным в группах без иммунизации перорально инокулировали 20 мл бульона BHI с добавлением 10% FBS. Все животные были предварительно обработаны за 90 минут до инокуляции ранитидином 0,75 мг / кг (Zantac ™, GlaxoSmithKline, Genval, Бельгия) для снижения продукции желудочной кислоты.

Через три недели после (фиктивной) иммунизации пять животных из каждой группы были заражены вирулентным штаммом B204 B. hyodysenteriae в течение трех дней подряд путем пероральной инокуляции (день 19, день 20, день 21), как описано выше для иммунизации. напряжение.Эти зараженные животные служили животными-сеялками для оставшихся пяти животных (приемников) в каждой группе.

Животных ежедневно наблюдали на предмет диареи и других признаков болезни. В период после иммунизации до заражения образцы фекалий собирали три раза в неделю у иммунизированных животных. Из этих образцов фекалий экстрагировали ДНК, как описано выше, для определения экскреции иммунизирующего штамма, и фекалии оценивали, как описано для испытаний на вирулентность.Эти образцы фекалий также использовали для определения наличия фекального IgA против B. hyodysenteriae . Образцы фекалий неиммунизированных животных собирали один раз в течение этого периода для подтверждения отсутствия B. hyodysenteriae и фекального IgA против B. hyodysenteriae . После контрольного заражения у всех животных брали пробы фекалий два раза в неделю. Эти образцы оценивали и экстрагировали ДНК для определения выведения иммунизирующего и / или контрольного заражения B., штамм hyodysenteriae . Эти образцы фекалий использовали также для определения наличия фекального IgA против B. hyodysenteriae .

Животных взвешивали в начале испытания (перед иммунизацией), после иммунизации на 17 день и при вскрытии трупа. Для каждого животного рассчитывалась среднесуточная прибавка в весе. Образцы крови для определения присутствия B. hyodysenteriae реактивного сывороточного IgG отбирали перед иммунизацией (день -13) и перед контрольным заражением (день 17).

Животных умерщвляли на 50–52 день (30–32 дня после заражения) или раньше, если отмечались апатия или депрессия. Эвтаназию проводили, как описано для испытаний на вирулентность.

КПЦР, дифференцирующая между иммунизирующим и контрольным штаммами

Для того, чтобы конкретно определить количество B. hyodysenteriae ДНК иммунизирующего штамма и контрольного штамма в образцах фекалий и кишечника, были разработаны праймеры для специфического отжига с ДНК либо штамм.Праймеры были основаны на гене гемолизина III из обоих штаммов: D28 (GenBank KU215635) и B204 (GenBank JXND01000108) [23, 27]. Для специфического обнаружения иммунизирующего штамма D28 использовали следующие праймеры: HlyVacFo 5’TGGTGAAATACTGCCAAAA3 ‘и HlyVacRe 5’TGTTGTTATATCGTCCATAC3’. Для специфического обнаружения штамма заражения использовали следующие праймеры: HlyInfFo 5’GTTAATGCTGAAAAAATGATG3 ‘и HlyInfRe 5’AAGCTCTTGTATGGAATATAC3’. Для обоих штаммов использовали следующую пару праймеров для создания ампликона, который будет использоваться в качестве стандарта: HlySTFo 5’CAAGTTCTATGATACCTAC3 ‘и HlySTRe 5’GCCGCCTTTAACATAYTCTTT3’.Количественную ПЦР проводили в системе CFX96 ™ RT-PCR с термоциклером C1000 (Bio-Rad, Hercules CA, США). Два мкл ДНК суспендировали в 10 мкл реакционной смеси, состоящей из SensiMix ™ SYBR No-ROX (Bioline Reagents Ltd, Великобритания), воды для ВЭЖХ и праймеров в концентрации 1,5 мкМ для контрольного штамма и 0,5 мкМ для иммунизирующего штамма. Программа ПЦР состояла из денатурации в течение 10 минут при 95 ° C, затем 40 циклов при 95 ° C в течение 30 с и 60 ° C в течение 30 секунд. Стандарты и образцы были проанализированы в двух экземплярах.Реакции для обоих штаммов проводили отдельно, поскольку оба ампликона генерировали температуру плавления 74,5 ° C и не могли быть различимы по их температурам плавления. Программное обеспечение Bio-Rad CFX Manager (версия 1.6) использовалось для расчета значений пороговых циклов ( Ct ) и анализа кривой плавления амплифицированной ДНК.

Иммуноферментный анализ (ELISA) для специфического определения сывороточного IgG и фекального IgA против

B. hyodysenteriae

Для обнаружения антител против B. hyodysenteriae штаммов D28 или B204, для обоих штаммов были приготовлены ИФА целых клеток, как описано ранее для Salmonella enterica [28]. Каждый штамм выращивали в BHI с 10% FBS в течение 48 ч на качающейся платформе при 37 ° C. Культуры инактивировали добавлением 0,18% (об. / Об.) Формалина. Суспензии инактивированных B. hyodysenteriae промывали фосфатно-солевым буфером (PBS) с 0,18% формалином (об. / Об.) И, наконец, ресуспендировали в буфере для покрытия (1.08 г Na 2 CO 3 · 10H 2 O, 0,968 г NaHCO 3 , 0,25 л воды и инъекций 100% мас. / Об.). Планшеты F96 Nunc -muno (Nunc International, Роскилле, Дания) покрывали 140 мкл инактивированного B. hyodysenteriae в буфере для покрытия, разбавленного до оптической плотности 0,3 при 660 нм. После 24-часового инкубационного периода при 4 ° C планшеты трижды промывали 100 мкл промывочного буфера (0,6 г NaH 2 PO 4 · 2H 2 O, 5.6 г NaH 2 PO 4 · 12H 2 O, 0,5 мл Твин 20, 12,5 г NaCl). Планшеты хранили при 4 ° C до дальнейшего использования.

Лунки предварительно инкубировали с 1% раствором сухого обезжиренного молока в дистиллированной воде в течение 15 минут для блокирования неспецифического связывания. Для обнаружения IgG в образцах сыворотки в лунки добавляли 100 мкл сыворотки, разведенной 1/200, и инкубировали в течение 30 мин при комнатной температуре. После инкубации лунки пять раз промывали промывочным буфером, после чего 100 мкл 1/20 000 разведения конъюгированного с пероксидазой хрена анти-свиного IgG (Sigma-Aldrich, St.Луис, Миссури, США). После 30 мин инкубации лунки промывали пять раз промывочным буфером и добавляли 100 мкл реагента 3,3 ‘, 5,5’-тетраметилбензидина (Sigma-Aldrich, Сент-Луис, Миссури, США). Ферментативную реакцию останавливали через 10 мин добавлением 100 мкл 1 н. HCl. Оптические плотности измеряли на спектрофотометре (Multiskan MS, Thermofisher Scientific, Waltham, MA, USA) при 450 нм.

Для обнаружения IgA в образцах фекалий готовили экстракты, как описано Peeters et al.[29]. Один грамм замороженных фекалий взвешивали и помещали на лед. Добавляли три мл буфера для экстракции (PBS, 0,5% Tween 20%, 0,05% NaN 3 ) и суспензию центрифугировали при 4 ° C в течение 20 минут при 1500 g . Супернатант собирали в пробирку Эппендорфа на 2 мл (Eppendorf, Гамбург, Германия). Добавляли 20 мкл ингибитора протеиназы (Sigma-Aldrich, Сент-Луис, Миссури, США) перед центрифугированием в течение 10 мин при 3000 g при 4 ° C. Супернатант собирали и хранили при -20 ° C до дальнейшего использования.Для обнаружения IgA, реактивного с B. hyodysenteriae в этих экстрактах фекалий, проводили ELISA, как для определения IgG в сыворотке со следующими изменениями: экстракты фекалий использовали неразбавленными и инкубировали в течение 60 мин, вторичные антитела, козьи антибиотики. -porcine IgA (Bio-rad, Кидлингтон, Великобритания) использовали в разведении 1/5000.

Статистический анализ

Корреляция между экскрецией с фекалиями и показателем фекалий определялась с помощью корреляции порядка рангов Спирмена (r) и выполнялась с помощью SPSS 22.0 (SPSS Inc, Чикаго, США). В модели вакцинации сеялки показатели фекалий анализировали с использованием кумулятивной регрессии логит-связи. Были включены взаимодействия между временем, типом и лечением, а также случайные эффекты на индивидуальном уровне для контроля псевдорепликации в отдельных временных рядах и эффект пера для учета кластеризации. Анализ был выполнен с использованием пакета «порядковый номер» в R. Анализ фекального экскреции был повторен, на этот раз с использованием линейной смешанной модели (пакет «lme4» в R) с теми же предикторами, что и выше.

Влияние лечения на среднесуточный прирост веса анализировали с помощью линейной регрессии. Влияние фекального ответа IgA на время начала SD анализировали в два этапа. Во-первых, измерения для отдельных животных, собранные через регулярные промежутки времени (3, 6, 10, 13 и 17 дней после заражения), были проанализированы с использованием модели выживания, оценивая, задерживается ли вероятность индивидуального развития SD более сильным фекальным IgA. отклик. Использование модели выживания позволило нам учесть цензуру (у некоторых людей не развилось заболевание к моменту завершения эксперимента).Чтобы уловить несколько возможностей, анализ модели выживаемости был повторен с использованием в качестве переменной ответа альтернативно максимальное значение IgA, среднее арифметическое и среднее геометрическое за все дни до первого уведомления о признаках заболевания для данного человека. Среднее геометрическое использовалось, чтобы лучше отразить возможную зависимость между последовательными измерениями IgA у одного и того же человека. Все три модели выживания включали фиксированный эффект для индивидуального типа (сеялка / приемник) и случайный эффект на уровне пера для учета кластеризации.Все анализы фекальных IgA-ответов проводили с использованием пакета «выживаемость» в R. Для всех анализов уровень статистической значимости был установлен на α = 0,05.

Иммунизация — диарея, диарея — диалог о диарее в Интернете

DDOnline Иммунизация Дополнение к DD30 5 Страница 6

СПИСОК РЕСУРСОВ ИСТОЧНИКИ ИНФОРМАЦИИ И ОБОРУДОВАНИЯ

  • Агентство международного развития (AID), Управление здравоохранения, Бюро науки и технологии, Агентство международного развития, Вашингтон, округ Колумбия 20523, U.С.А. КОНТАКТ: Д-р Кеннет Барт
  • Американская ассоциация общественного здравоохранения (APHA), 1015 15th Street, NW, Вашингтон, округ Колумбия 20005, США. КОНТАКТ: д-р Susi Kessler
  • Группа действий по соответствующим ресурсам и технологиям здравоохранения (AHRTAG), 85 Мэрилебон Хай-стрит, Лондон W1M 3DE, U.K. КОНТАКТЫ: г-жа Сюзанна Фустукиан
  • Центры по контролю за заболеваниями, Служба общественного здравоохранения, Департамент здравоохранения и Социальные службы, Атланта, GA 30333, U.S.A. КОНТАКТЫ: Д-р Алан Хинман, д-р Стэнли Фостер
  • Оборудование для зарубежных благотворительных больниц (ECHO), Ullswater Crescent, Coulsdon, Surrey CR3 2HR, U.K. КОНТАКТ: Д-р Джон Таунсенд
  • Центр оценки и планирования здравоохранения (EPC), LSHTM, Keppel Street, London WC1E 7HT, U.K. КОНТАКТЫ: Dr Patrick Vaughan
  • Международный детский центр, Chateau de Longchamp, Bois de Boulogne, F-75016, Париж, Франция, КОНТАКТЫ: Д-р Н.Guerin
  • Институт детского здоровья, Тропическое отделение детского здоровья, 30 Гилфорд-стрит, Лондон WC1, U.K. КОНТАКТЫ: профессор Дэвид Морли
  • Лига обществ Красного Креста и Красного Полумесяца, C. P. 372, 1211 Женева 19, Швейцария, КОНТАКТЫ: Marianne Enge
  • Панамериканская организация здравоохранения, Расширенная программа иммунизации, 525 23-е Street, NW, Вашингтон, округ Колумбия 20037, США. КОНТАКТ: Д-р Сиро де Квадрос
  • ПРОГРАММА ПОЛИОПЛЮС, Ротари Интернэшнл, 1600 Ридж-авеню, Эванстон, Иллинойс 60201, U.S.A, КОНТАКТЫ: г-н Майкл МакКуэстион
  • Программа соответствующих технологий в здравоохранении (PATH), Canal Place, 4 Nickerson Street, Сиэтл, WA 98109, США. КОНТАКТ: г-жа Вивьен Цу
  • .
  • Ресурсы для здоровья детей (REACH) Project, John Snow, Inc., 1100 Wilson Blvd., 9-й этаж, Арлингтон, Вирджиния 22209, США. КОНТАКТЫ: д-р Пьер Клакен, д-р Норберт Хиршхорн
  • Save the Children Fund, Grove Lane 17, London SE5 8RD, U.К. КОНТАКТ: Д-р Питер Пур
  • Учебные пособия по низкой цене (TALC), P.O. Box 49, St Albans, Herts, AL1 4AX, U.K. КОНТАКТ: г-жа Барбара Харви
  • UNICEF, 866 United Nations Plaza, New York, NY 10017, США. КОНТАКТЫ: Dr Теренс Хилл
  • UNIPAC, Центр закупок и сборки ЮНИСЕФ, ЮНИСЕФ Plaus, Freepost — DK2100, Копенгаген, Дания, КОНТАКТЫ: г-н Фред Ирмер
  • Всемирная организация здравоохранения (ВОЗ), Расширенная программа иммунизации, 1211 Женева 27, Швейцария, КОНТАКТЫ: Д-р Р.Х. Хендерсон

КНИГИ / РУКОВОДСТВА AHRTAG, Battersby A. Как выбрать и изготовить холодильный ящик, 1984.

AHRTAG, Elford J. Как ухаживать за холодильником, 1980, 1983 (пересмотренная версия).

Child Alive, Узнайте больше об иммунизации, Лига Красного Креста и Красного Полумесяца Общества, 1986.

Dick B, Проблемы иммунизации в развивающихся странах: обзор, EPC 1985.

Расширенная программа иммунизации, Информационные листы о продуктах холодовой цепи, ВОЗ / ЮНИСЕФ.1987.

Favin. М., Сабин. Э., и Стинсон. W. Immunizations, World Federation of Public Ассоциации здравоохранения, Женева, май 1984 г.

Heggenhougen K, and Clement J, Приемлемость детской иммунизации: социальная научные перспективы, EPC, 1987.

Университет Джона Хопкинса, Программа демографической информации, Immunizing the World’s Дети, Population Reports, Series L, Number 5, March-April 1986, Issues in World Здоровье.

King M. и др., Primary Child Care, Vols I и II, TALC, 1978.

Либерия, Министерство здравоохранения и социального обеспечения, EPI Справочник по Healthworkers, 1982, EPI, P.O. Box 3600, Монровия, Либерия.

ПРОГРАММА ПОЛИОПЛЮС, Задача, Руководство к действию для национальных проектов ПОЛИОПЛЮС, 1987, Ротари Интернэшнл.

Фонд Рокфеллера, Защита детей мира: вакцины и иммунизация, (Представлено на конференции в Белладжио, 13-15 марта 1984 г., Нью-Йорк, 1984 г.

Целевая группа по выживанию детей, Защита детей мира: Белладжио II, (Представлено на Картахенской конференции, 14-16 октября 1985 г.) Decatur, GA, 1986.

UNICEF, The State of the World’s Children, 1986, Oxford University Press, 1986.

ЮНИСЕФ, Всеобщая иммунизация детей к 1990 г., Назначение детей 69/72, 1985 г.

ВОЗ, Иммунизация на практике: Руководство для медицинских работников, вводящих вакцины, ВОЗ Учебный курс.

ВОЗ, Логистика и холодовая цепь для первичной медико-санитарной помощи, Учебный курс ВОЗ.

ВОЗ, Справочник техника по компрессорным холодильникам, Учебный курс ВОЗ.

ВОЗ, Учебный курс для менеджеров среднего звена, Учебный курс ВОЗ.

ВОЗ, Учебный курс по планированию и управлению, Учебный курс ВОЗ.

СТАТЬИ Haaga, J. Анализ экономической эффективности и затрат-выгод программ иммунизации в Развивающиеся страны в Джеллиффе, Д.and Jelliffe, E. eds., Advances in International Здоровье матери и ребенка, т. 6, Oxford University Press, Нью-Йорк, 1986.

Фичем Р. Г. и Коблински. M. A. Меры борьбы с диареей1 Болезни среди детей раннего возраста: иммунизация против кори, Бюллетень всемирного здравоохранения Организация 61 (4), 1983, стр. 641-652.

Foster, S.O., Иммунизационные заболевания, респираторные заболевания и детская смертность Население и «Обзор развития», осеннее приложение 1984 г.

AUDIOVISUALS Cold Chain — Target Diseases, (24 слайда) TALC.

Холодная цепь, (24 слайда) TALC.

Primary Child Care, (240 слайдов) TALC.

Тяжелая корь, (24 слайда) TALC.

БЮЛЛЕТЕНИ ARI News , AHRTAG.

Информационный бюллетень Child Alive, Лига обществ Красного Креста и Красного Полумесяца.

Обновление холодовой цепи EPI, ВОЗ.

Информационный бюллетень EPI, Расширенная программа иммунизации, ПАОЗ, 525 23-я улица, северо-запад, Вашингтон, округ Колумбия 20037, США

Обратная связь, Офис Международной программы здравоохранения, Центры по контролю за заболеваниями, Служба общественного здравоохранения, Департамент здравоохранения и социальных служб, Атланта, Джорджия, 30333, США. А.

Future, Региональный офис ЮНИСЕФ в Юго-Восточной Азии, Дом ЮНИСЕФ, 73 Лоди Estate, Нью-Дели 110003, Индия.

Immunizations, Международный детский центр, Париж.

Еженедельный эпидемиологический бюллетень, ВОЗ.

World Immunization News (WIN), Целевая группа по выживанию детей, Север 1989 г. Williamsburg Drive, Suite I, Decatur, GA 30033, США. Благодарность Эта информация подготовлена ​​REACH (Ресурсы по охране здоровья детей), Девятый этаж, 1100 Wilson Boulevard, Arlington, VA 22209, U.S.A. DD особенно хотел бы поблагодарить Пьера Клэкина, Норберта Хиршхорна, Синтию Ворона, Пол Стил и Роберт Стейнгласс.REACH — это проект компании John Snow Inc., подрядчик Агентства США по международному развитию (AID), предоставляющий краткосрочная и долгосрочная техническая помощь в области иммунизации и финансирования здравоохранения, а также Поддержка систем первичной медико-санитарной помощи странам, которым помогает AID.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *