Щетка красная какой содержит гормон: Красная щётка лечебные свойства для женщин

Содержание

Красная щетка

Описание

Красная щётка (родиола холодная Rhodiola algida, Ledeb, родиола четырёхнадрезанная или четырехчленная Rhodiola quadrifida Pall.) – два вида многолетних растений семейства толстянковых. Красная щетка является эндемиком Алтая. Растет в альпийском поясе, по скалам, берегам рек и ручьев, каменистых склонам, в щебнисто-лишайниковой тундре.

Для медицинских целей используют корневища с корнями красной щетки.

Состав

Основной биологический эффект красной щетки формирует гликозид салидрозид, содержание которого достигает 1,5 %.

Корневище с корнями красной щетки содержат дубильные вещества пирогалловой группы (до 20 %), антрагликозиды, эфирное масло, органические кислоты (щавелевая, лимонная, яблочная, галловая, янтарная), значительное количество сахаров, белки, жиры, воски, стерины, значительное количество марганца, который имеет особое значение в реализации функции половых желез.

Свойства

Многокомпонентный химический состав растения обуславливает многофункциональность действия красной щётки. Одно из основных действующих веществ — гликозид салидрозид способствует проявлению противовоспалительных, противоинфекционных и адаптогенных свойств растения, активизирует функцию щитовидной железы, эффективен для усиления иммунных реакций человека. Дубильные вещества и антоцианы, содержащиеся в растении, обеспечивают противоопухолевые, бактерицидные свойства, а флавоноиды обуславливают участие растения в формировании антиоксидантного статуса организма.

На фоне выраженного действия в профилактике заболеваний женской половой сферы, биологически активные вещества красной щетки обладают стимулирующим свойством, нормализуют обменные процессы, улучшают энергетический обмен в мышцах и мозге за счет окислительных процессов, сопряженных с фосфорилированием, более ранним использованием в качестве субстратов окисления не только углеводов, но и липидов.

Применение

Корни и корневища красной щетки традиционно используются в Азии как адаптоген, антидепрессант, тонизирующий и противовоспалительный препарат.

В народной медицине Алтая красная щетка используется женщинами для лечения мастопатии, миомы матки, эрозий, кист, эндометриозов, болезненных и нерегулярных месячных циклов, опухолей различной этиологии.

Входит в состав следующих препаратов:

Капли Organic Herbs Фемофит 50 мл

ЖЕНСКИЕ ТРАВЫ: МАТКА БОРОВАЯ, КРАСНАЯ ЩЕТКА

КОРРЕКЦИЯ ВОСПАЛИТЕЛЬНЫХ И ГОРМОНАЛЬНЫХ РАССТРОЙСТВ

Капли "ФЕМОФИТ ЖЕНСКИЕ ТРАВЫ" линейки "Organic Herbs" - натуральный продукт, созданный из растительного сырья, который успешно применяют при заболеваниях женской половой сферы, а также для профилактики таких заболеваний.

Создаёт оптимальные диетологические условия для улучшения функционирования репродуктивной системы, имеет мягкий успокоительный эффект. Содержит все необходимые компоненты, которые помогут улучшить состояние женского организма в период болезни (цистит, воспалительные процессы в органах малого таза), а также поможет поддерживать себя в хорошей форме постоянно. Может использоваться и как профилактическое средство против женских болезней на протяжении неограниченного времени. Сохранение здоровья и продление молодости важно не только для репродуктивной системы женщины, но и её красоты в целом (состояния кожи, волос, фигуры). Понятие молодости женщины неотделимо связано с гормональным циклом и здоровьем репродуктивной системы. Капли "ФЕМОФИТ ЖЕНСКИЕ ТРАВЫ №2" - комплексный подход к проблемам красоты и здоровья.

Без ГМО

Препараты серии "ФЕМОФИТ ЖЕНСИКЕ ТРАВЫ" прошли все необходимые лабораторные исследовании

Имеют положительный опыт применения

Для достижения максимального эффекта рекомендуется комплексное применение серии "ФЕМОФИТ ЖЕНСКИЕ ТРАВЫ"

Сертифицировано по стандартам GMP (ISO 22716:2007)

Женские проблемы решают женские травы!

Матка боровая способна продлить женщине молодость, задержать наступление климакса, помогают справится с нарушениями и воспалениями внутренних репродуктивных органов. Увеличивает функциональную активность матки и придатков. Улучшает работу репродуктивной системы в целом, помогает справится с нарушениями менструального цикла.

Красная щетка эффективна при мастопатии, аднексите, кистах яичников, климаксе, нерегулярном менструальном цикле, чрезмерном кровотечении в период менструации, а также в период реабилитации онкобольных. Биологические свойства красной щетки позволяют устранить такие заболевания, как зоб, увеличение щитовидной железы), воспаления лимфоузлов, надпочечников. Красная щетка содержит натуральный растительный гормон, который по своему составу сходен с гормоном щитовидной железы человека. Красная щетка содержит сахара, гликозиды, дубильные вещества, слизистые вещества, растительные белки и сахара. Целебная сила красной щетки настолько высока, что с её помощью можно на начальных стадиях нормализовать нарушенный вследствие различных причин обмена веществ, а также избежать гинекологических заболеваний, связанных с гормональными нарушениями и болезней щитовидной железы. Кроме того, красная щетка проявляет еще и противогрибковые свойства, улучшает иммунитет и способствует повышению резистентности организма к различным вирусам и инфекциям.

Свойства:

  • быстрое действие
  • противовоспалительное
  • кровоостанавливающее действием
  • снижает риск роста опухолей и предотвращает их появление
  • улучшают кровообращение
  • тормозят воспалительные процессы в органах малого таза
  • улучшает сопротивляемость организма инфекциям
  • применяется также для профилактики и лечения таких заболеваний, как атеросклероз, анемия, сердечные болезни,  лейкозы
  • эффективная помощь при мастопатии и застойных явлениях в организме, нерегулярном менструальном цикле, чрезмерном кровотечении в период менструации, а также в период реабилитации больных после лучевой терапии.
  • содержит целый комплекс полезных веществ, положительно влияющих на состояние всей репродуктивной системы женщин и функцию женских половых органов
  • профилактика новообразований в матке – фибром, фибромиом, миом
  • снижают риск роста опухолей
  • улучшают иммунитет и сопротивляемость организма инфекциям
  • отличный имуномодулятор и антиоксидант
  • тонизирующее
  • улучшают аппетит
  • омолаживает организм
  • спазмолитическое
  • регулирует менструальный цикл
  • усиливает секреторную функцию ЖКТ, бронхиальных желез

Рекомендации к применению:

Рекомендовано употреблять как диетическую добавку к рациону питания для улучшения функционирования репродуктивной системы женщин.

  • для профилактики и лечения гинекологических заболеваний
  • при нарушении гормонального фона у женщин в следствии воспалительных процессов, физиологической или послеоперационной менопаузы, новообразований, нарушения гигиены, питания и стрессов
  • при нарушении работы всей репродуктивной системы
  • рекомендуется в комплексной терапии как вспомогательное средство при дисфункциональных маточных кровотечениях
  • для нормализации менструаций
  • для уменьшения воспалений в гениталиях
  • в климактерическом периоде
  • при миоме.

Способ применения:

Женщинам 20-30 капель развести в 0,5 стакана воды, Принимать 2-3 раза в день до приёма пищи.

Курс приема 30 дней. При необходимости курс можно повторить.

Перед применением рекомендуется проконсультироваться с врачом.

Противопоказания:

Индивидуальная чувствительность к компонентам препарата, беременность, период лактации. Детям до 14 лет. Лихорадка. Психологическое возбуждение. Высокое артериальное давление. При приёме гормонов (синтетических или природных). Не совместимо вместе с травами: хмель, клевер, солодка, дурнушник.

Условия и сроки хранения:

Хранить в упаковке производителя, в сухом, защищенном от света помещении при температуре от 5°С до 25°С, 24 месяца от даты изготовления.

Форма выпуска:

Флакон 50мл

Серия «ФЕМОФИТ ЖЕНСКИЕ ТРАВЫ» - это восстановленная рецептура биологически активных сборов, предназначена для комплексного лечебно-профилактического применения фитокомпозиций со специальными "женскими" травами. Для достижения максимального эффекта рекомендуется комплексное использование серии «ФЕМОФИТ ЖЕНСКИЕ ТРАВЫ», которая включает в себя такие взаимодополняющие средства:

2 вида фиточая:

Средства для ежедневной интимной гигиены:

Для внутреннего применения:

Данная продукция не является препаратом медицинского назначения. 

При использовании и перепечатке материала активная ссылка на 

goldenfarm.com.ua обязательна.

СПРАВКА

Симптомы гинекологических заболеваний:

Боли – различные по интенсивности и характеру, локализованные в области малого таза или отдающие в поясницу, ноги , плечи, голову.

Измененные усиливающиеся выделения из половых органов женщины, иногда сопровождаются зудом и жжением. Могут быть белые, прозрачные (стекловидные), молочные, желтовато-зеленые (с примесью гноя) и сукровичные (с примесью крови

Кровотечения беспричинные, эпизодические.

Виды патологий репродуктивной системы:

Воспалительные заболевания:

Возбудители – болезнетворные микроорганизмы – стрептококки, стафилококки, которые попадают в организм как извне, так и через кровь и лимфу (при наличии другого основного серьезного диагноза) и вызывают различные по тяжести заболевания:

Вагинит или кольпит – воспаление слизистой оболочки влагалища. Чаще сочетается с воспалением наружных половых органов – вульвовагинит,сопровождается покраснением наружных половых органов.

Эндометрит – воспаление внутренней (слизистой) оболочки матки (эндометрия), обычно протекает с повышенной температурой. При своевременном лечении измененная (пораженная бактериями) слизистая отторгается и на ее месте образуется новая оболочка.

Сальпингит – воспаление маточной трубы. При воспалении ее слизистой оболочки начинается омертвление поверхностных слоев маточной трубы и склеивание стенок, что препятствует проходимости яйцеклетки через нее (может привести к внематочной беременности и бесплодию, если поражены обе трубы). Далее воспалительный процесс переходит на яичник – оофорит и развивается воспаление придатков – сальпингоофорит, ил андексит.

Опухлевые заболевания:

Миома (или фибромиома) матки – опухоль из мышечных и соединительных тканей матки.

Киста яичника – опухоль с полостью, наполненной жидкостью. Это доброкачественные опухоли.

Возможны и запущенные злокачественные новообразования.

Гормональные расстройства:

Нарушение овуляции (менструального цикла) – отклонения от нормального цикла созревания яйцеклетки.

Гиперплазия (или гипертрофия) матки и молочной железы – патологическое увеличение размеров органа.

Мастопатия – группа заболеваний молочной железы – припухлости различной величины и плотности. В запущенных стадиях переходит в злокачественную опухоль, о чем нельзя забывать, особенно в климакретический период (гипоэстрогения – угасание функции яичников, недостаточная продукция гормонов эстрогенов).

Диетическая добавка ФитоБиоТехнологии Чай Фемофит №2 20 пак

Фемофит №2 Фиточай - это натуральный чай, состоящий из растительных компонентов – фитосырья матки боровой и красной щетки.

Красная щетка
как самостоятельное лечебное средство применяется не только при женских болезнях, но и при таких заболеваниях, как атеросклероз, анемия, сердечные болезни. Красная щетка эффективна при мастопатии, нерегулярном менструальном цикле, чрезмерном кровотечении в период менструации, а также в период реабилитации онкобольных.. Биологические свойства красной щетки позволяют устранить такие заболевания, как зоб, увеличение щитовидной железы), воспаления лимфоузлов, надпочечников.
Красная щетка содержит натуральный растительный гормон, который по своему составу сходен с гормоном щитовидной железы человека. Красная щетка содержит сахара, гликозиды, дубильные вещества, слизистые вещества, растительные белки и сахара. Целебная сила красной щетки настолько высока, что с её помощью можно на начальных стадиях нормализовать нарушенный вследствие различных причин обмена веществ, а также избежать гинекологических заболеваний, связанных с гормональными нарушениями и болезней щитовидной железы.

Кроме того, красная щетка проявляет еще и противогрибковые свойства, улучшает иммунитет и способствует повышению резистентности организма к различным вирусам и инфекциям. Красная Щётка обладает отличными иммунными и адаптогенными свойствами для восстановления организма. Особенностью Красной Щётки считается то, что она может помочь избавиться не от следствия болезни, а от первопричины ее возникновения. Про нее говорят, что это – чистая капля, способная очистить целый океан. Уникальность Красной Щётки заключается в биологическом омоложении больного органа.

Биологически активные вещества Матки Боровой, способны продлить женщине молодость, задержать наступление климакса, помогают справиться с нарушениями и воспалениями внутренних репродуктивных органов. Способствуют поддержанию иммунитета, увеличению функциональной активности матки и придатков, улучшают работу репродуктивной системы в целом, помогают справиться с нарушениями менструального цикла.

Свойства:
- сильный фитоэстроген
- устраняет первопричину болезней
- повышает умственную и физическую работоспособность
- общеукрепляющее, адаптогенное
- иммуномодулирующее, тонизирующее действие
- мочегонный эффект
- нормализующее действие на половую функцию женщин
- регулирует менструальный цикл.

Рекомендации к применению:
- для улучшения функционирования репродуктивной системы женщин.
- для профилактики и лечения гинекологических заболеваний
- при нарушении гормонального фона у женщин в следствии воспалительных процессов, физиологической или послеоперационной менопаузы, новообразований, нарушения гигиены, питания и стрессов
- при нарушении работы всей репродуктивной системы
- оправданы для лечения гипоэстрогенных состояний, как альтернатива или дополнение синтетическим эстрогенам.

Препараты серии "Фемофит Женские травы":
- Прошли все необходимые лабораторные исследования
- Имеют положительный опыт применения
- Для достижения максимального эффекта рекомендуется комплексное применение серии "Фемофит Женские травы"
- Сертифицировано по стандартам GMP (ISO 22716:2007).

Красная щетка | Травы Сибири

Упаковка полиэтиленоваябумажная

Если вы ищете, где купить красную щетку, то наш интернет магазин трав способен помочь. Это растение также может встречаться под названием родиола четырехчленная или сибирский женьшень. Оно представляет собой довольно редкое растение, которое произрастает на каменистых горных склонах.

Где применяется:
Корень красной щетки применяется в народной медицине с лечебной целью и содержит большое количество полезных веществ, соединений и микроэлементов. Так, в нем содержится ликозид салидрозид, являющийся основным компонентом и наделяет данное растение уникальными свойствами, за которые оно ценится. Это вещество обладает противораковым и антибактериальным свойством, а также позволяет снимать воспаление.

Красная щетка представляет собой эффективный природный гормон, который известен в народе благодаря своим уникальным лечебным свойствам. С давних времен его использовали с целью устранения нарушений щитовидной железы, лимфоузлов, а также надпочечников, а в настоящее время к данному средству проявляют интерес европейские и китайские медики. Также красную щетку применяют женщины в случае недомогания при месячных, поскольку растение способствует нормализации обмена веществ, снятию болезненных симптомов. Трава красной щетки, точнее даже ее корень – это эффективное средство, которое используется при миоме матки, возникновении кисты и при поликистозе, при климаксе и при мастопатии. Купить красную щетку могут также мужчины, ведь данное средство способствует повышению потенции. Довольно часто, для лучшего эффекта красную щетку принимают вместе с боровой маткой.

Существует множество способов применения этого растения с лечебной целью. Так, оно может использоваться для приготовления отваров, для перорального применения или спринцевания, а также для изготовления спиртовых настоек. Еще из красной щетки и прочих трав может быть приготовлен сборный фиточай. Однако, для достижения максимального эффекта, доверить составление сбора лучше следует опытному фитотерапевту.

Рекомендации к применению:
1 столовую ложку измельчённого корня красной щетки залить 300 мл. воды, довести до кипения и варить на медленном огне 15 минут в эмалированной кастрюле с закрытой крышкой. После этого дать настояться 1 час и затем процедить. В отвар добавить чайную ложку меда и принимать по пол стакана 3 раза в день, за 30 минут до еды.

Если вы ищете, где заказать лекарственные травы с доставкой, то наш интернет магазин «Травы Сибири» предлагает купить траву красная щетка и другие целебные растения Алтая по самым приемлемым ценам.

Противопоказания:
Беременность, кормление грудью, гипотония, нарушения сердечной деятельности, нервная нестабильность (возбудимость), индивидуальная непереносимость.

Заготовлено дата изготовления на упаковке
Срок годности 2 года.

Фемофит женские травы №2 1,5 г №20 фиточай пак.

Фемофит №2 фиточай 1,5г №20 (матка боровая + красная щетка):

Фемофит №2 фиточай 1,5г №20 (матка боровая + красная щетка)

Фемофит фиточай №2 – это натуральный чай, состоящий из растительных компонентов – фитосырья матки боровой и красной щетки. Эти два растения уже очень много лет применяют как лечебные и профилактические средства при женских болезнях, а также кровотечениях – внешних и внутренних.

Боровая матка – женская трава – содержит целый комплекс полезных веществ, положительно влияющих на состояние и функцию женских половых органов, всей репродуктивной системы женщин. Данное растение также имеет название Средство от сорока болезней, поскольку успешно лечит не только заболевания мочеполовой системы, но и заболевания почек. Также боровая матка показывает отличные результаты в борьбе с профилактикой и развитием уже имеющихся миом. Новообразования опасны тем, что могут нанести непоправимый вред здоровью и воспрепятствовать возможности забеременеть. Именно потому фитотерапевты рекомендуют использовать траву боровой матки для лечения и профилактики женских заболеваний. Боровая матка содержит дубильные вещества, витамины, микроэлементы, эфирное масло. Она обладает вяжущим, противовоспалительным, кровоостанавливающим действием, снижает риск роста опухолей, улучшает кровообращение, тормозит воспалительные процессы.

Красная щетка как самостоятельное лечебное средство применяется не только при женских болезнях, но и при таких заболеваниях, как атеросклероз, анемия, сердечные болезни, лейкозы.
Красная щетка эффективна при мастопатии, нерегулярном менструальном цикле, чрезмерном кровотечении в период менструации, а также в период реабилитации онкобольных. Биологические свойства красной щетки позволяют устранить такие заболевания, как зоб, увеличение щитовидной железы), воспаления лимфоузлов, надпочечников. Красная щетка содержит натуральный растительный гормон, который по своему составу сходен с гормоном щитовидной железы человека. Красная щетка содержит сахара, гликозиды, дубильные вещества, слизистые вещества, растительные белки и сахара.
Целебная сила красной щетки настолько высока, что с её помощью можно на начальных стадиях нормализовать нарушенный вследствие различных причин обмена веществ, а также избежать гинекологических заболеваний, связанных с гормональными нарушениями и болезней щитовидной железы. Кроме того, красная щетка проявляет еще и противогрибковые свойства, улучшает иммунитет и способствует повышению резистентности организма к различным вирусам и инфекциям.

Фемофит фиточай №1 поможет провести профилактику заболеваний женской половой сферы или же улучшить самочувствие во время менструации, нормализует нерегулярный менструальный цикл, снизит воспаление, восстановит слизистую внутренних органов.

Используя чай Фемофит №2 с боровой маткой и красной щеткой как профилактическое средство и как дополнительное средство к основному лечению, назначенному врачом, вы можете быть уверены в положительном результате. Женские болезни отступают перед такими сильными народными средствами, как боровая матка и красная щетка.

ФЕМОФИТ фиточай №2:
МАТКА БОРОВАЯ
широко применяется при гинекологических заболеваниях воспалительного характера, помогает женщинам обрести здоровье и радость полноценной жизни.
КРАСНАЯ ЩЕТКА
обладает адаптогенным, противовоспалительным, иммуномодулирующим и тонизирующим действием, восстанавливает функции женского организма.

ФИТОЧАЙ «ФЕМОФИТ Nº2»
Матка Боровая и Красная Щётка – две легенды, настоящие феи-хранительницы хрупкого мира женского здоровья. Главное преимущество этого дуэта – всестороннее воздействие на всю мочеполовую систему, поскольку воспалительные процессы не проходят локально.
Биологически активные вещества Матки Боровой, способны продлить женщине молодость, задержать наступление климакса, помогают справиться с нарушениями и воспалениями внутренних репродуктивных органов. Способствуют поддержанию иммунитета, увеличению функциональной активности матки и придатков, улучшают работу репродуктивной системы в целом, помогают справиться с нарушениями менструального цикла.
Красная Щётка обладает отличными иммунными и адаптогенными свойствами для восстановления организма. Особенностью Красной Щётки считается то, что она может помочь избавиться не от следствия болезни, а от первопричины ее возникновения. Про нее говорят, что это – чистая капля, способная очистить целый океан. Уникальность Красной Щётки заключается в биологическом омоложении больного органа.

ФИТОЧАЙ «ФЕМОФИТ Nº2»

Диетическая добавка к рациону питания женщин - создает оптимальные диетологические условия для улучшения функционирования репродуктивной системы.

Содержание пакета - 30 г

Пищевая ценность 100 г:

белки - 1,5 мг
жиры - 1,0 мг
углеводы - 22,0 мг

Энергетическая ценность 100 г:

калорийность - 103,0 ккал

Состав: измельченные: трава боровой матки (Orthilia secunda L.) (50,0%), корни красной щетки (родиолы чотиричастковои) (Rhadiola quadrifida) (50,0%).

Употреблять: женщинам 1 пакетик чая залить 1 стаканом кипятка, дать настояться 30 минут, пить по одному стакану 1-2 раза в день за 30-40 минут до еды. Курс приема 30 дней. Перед применением рекомендуется проконсультироваться с врачом.

Противопоказания: индивидуальная непереносимость компонентов, беременность, период лактации, детям до 18 лет; лихорадка, психическое возбуждение, высокое артериальное давление, лицам, которые принимают гормоны (синтетические или природные). Несовместимо вместе с травами: хмель, клевер, солодка, дурнушник.
Не является лекарственным средством.

Красная щётка капли 50 мл: инструкция по применению, отзывы, цена на сайте

Препарат Красная щетка Мерцана капли для приема внутрь без спирта и без сахара, приготовленный на основе концентрированного экстракта родиолы четырехчленной (красной щетки). Красная щётка (родиола холодная) - используется женщинами для излечения мастопатии, миомы матки, эрозий, кист, эндометриозов, болезненных и нерегулярных месячных циклов, опухолей различной этиологии, у мужчин применяется при аденоме простаты. Красная щётка обладает выраженными кровоостанавливающим и мягким тонизирующим действиями.  


Использование корневищ с корнями красной щётки обусловлено тем, что именно эта часть растения содержит гликозид салидрозид, антоцианы, дубильные вещества, сахара, белки, жиры, воски и др. Многокомпонентный химический состав растения обуславливает многофункциональность действия красной щётки.
По мнению народных целителей - красная щётка уникальный природный гормон, устраняющий эндокринные нарушения: щитовидной железы, лимфоузлов, надпочечников и другие.

 

На сайте компании Мерцана вы можете купить экстракт Красной Щетки 50 мл по цене производителя с доставкой по Москве и России или оформить самовывоз.

 

Фармакологическая форма

Биологически активная добавка БАД к пищевым продуктам.

Свойства Красной щетки

КРАСНАЯ ЩЁТКА МЕРЦАНА обладает сильным противовоспалительным, антибактериальным, иммуностимулирующим действием, нормализует обмен веществ, улучшает энергетический обмен в мышцах и ЦНС.


Одно из основных действующих веществ - гликозид салидрозид способствует проявлению онкопротекторных, противовоспалительных, противоинфекционных и адаптогенных свойств растения, устраняя эндокринные нарушения при гинекологических заболеваниях, патологии щитовидной железы, надпочечников. Антоцианы вызывают профилактический и лечебный эффект при заболеваниях бактериальной, вирусной, грибковой этиологии.

 

Показания к применению

Мы рекомендуем применять препарат «КРАСНАЯ ЩЁТКА МЕРЦАНА» при эндокринных нарушениях, в том числе со стороны щитовидной железы; при инфекционных и воспалительных заболеваниях; при недомоганиях в период менструаций.

 

Как и другие препараты компании МЕРЦАНА, ПРЕПАРАТ «КРАСНАЯ ЩЁТКА МЕРЦАНА» представлен в капельной форме без содержания спирта и сахара, что позволяет его принимать даже диабетикам, водителям автотранспорта без ограничения права управления ТС. КРАСНАЯ ЩЁТКА МЕРЦАНА в каплях имеет высокую эффективность в том числе за счёт того, что усвоение и всасывание активных веществ происходит в ротовой полости, которые мгновенно попадают в кровь, минуя ЖКТ, в котором разрушается до 90% активного вещества, например, при приёме таблеток или капсул. По этой же причине препараты, представленные в капельной форме, как правило, не вызывают привыкания.

Состав

Вода очищенная, экстракт корневищ  родиолы четырехчленной (красной щетки), коллоидное серебро, антиокислитель: лимонная кислота, аскорбиновая кислота, консервант: бензоат натрия, подсластитель: «Аспасвит».

 

КРАСНАЯ ЩЁТКА МЕРЦАНА рекомендуется, как биологически активная добавка (БАД) к пище.

 

Производитель препарата Красная щетка ООО "КУРОРТМЕДСЕРВИС" (ГК МЕРЦАНА).

Свидетельство о государственной регистрации № RU.77.99.32.003.Е.008990.09.15

Алтайский Бальзам "Боровая Матка, Красная Щетка" 100 мл

Бальзам рекомендуется для женщин, способствует благотворному влиянию на репродуктивную функцию, оказанию противовоспалительного, антибактериального и иммуностимулирующего действия.

Активные действующие компоненты в алтайском бальзаме:
Боровая матка, красная щетка и минеральная вода «Серебряный ключ» в алтайском бальзаме благотворно влияет на репродуктивную функцию, оказывает антисептическое, иммуностимулирующее,  противовоспалительное и мочегонное действие.

Лекарственные растения боровая матка в сочетании с красной щеткой обладают кровеостанавливающим действием для нормализации сильных месячных со сгустками, а также при длительных и нерегулярных выделениях. Связано это с тем, что растения в своем составе содержит фитоэстрогены, а также активные вещества, регулирующие баланс гормонов в женском организме. Именно поэтому при регулярном применении этих растений уменьшается кровопотеря и выделение сгустков, снижается уровень боли во время критических дней, нормализуется продолжительность цикла. Применять бальзам можно в любой день цикла, курс лечения до 6 месяцев (зависит от индивидуальных особенностей организма), затем следует сделать перерыв на 10 дней.

Состав: сироп (сахар, вода питьевая), колер (сахар, вода питьевая), морс из растительного сырья (вода минеральная «Серебряный ключ», трава и листья боровой матки, корни и корневища красной щетки, корни и корневища родиолы розовой, плоды шиповника, лист земляники, плоды черемухи, орех кедровый, корни и корневища аира, лист бадана, плоды можжевельника, трава полыни, почки березы), сок черноплодной рябины, мёд, регулятор кислотности (лимонная кислота).

Рекомендации по применению: бальзам рекомендуем принимать 3 раза в день по 1-2 чайной ложки во время еды, можно добавлять в чай или в чистом виде. Курс приема 2-3 месяца, затем необходимо сделать перерыв в 10 дней, так как в состав бальзама входят натуральные компоненты.

Условия хранения: хранить при температуре не выше +25°С и относительной влажности не более 75%.

Срок годности: 24 месяца.

Не является лекарством.

Tinctura Rhodiola Quadrifida aka Red Brush, 250 мл ~ Аптека-24

Это довольно редкое растение. Произрастает только в Сибири. Вы можете встретить растение в некоторых уголках Урала. В некоторых районах встречается редко и занесен в Красную книгу, а в некоторых встречается чаще.

Среда обитания - зона альпийских лесов и лугов, где предпочитает каменистые склоны с известняковыми почвами. Растение невысокое, около 15 см высотой. Цветет с июня по июль. Внешне кисточка похожа на небольшой пушистый кустик округлой формы.За свои небольшие и часто расположенные листья и красноватый оттенок растение и получило свое название.

Однако главная ценность растения заключается в его подземной части - корне. Корень Red Brush очень толстый и мощный. Это корень красной щетки и используется в лечебных целях. Заготавливают корень сразу после цветения растения. Сушеное овощное сырье можно хранить 2 года.

В род родиолы входит еще одно популярное лекарственное растение - родиола розовая.Он также обладает лечебными свойствами, во многом аналогичными свойствам красной кисти. Оба растения часто используются вместе в сборах трав. Однако стоит помнить, что это все разные растения, и не всегда одно может заменить другое.

Что делает родиола квадрифида?

Список заболеваний, при которых он применяется, достаточно широк. Это заболевания сердечно-сосудистой системы, печени, почек, желудочно-кишечного тракта, нервной системы. Растение также используется для повышения иммунитета, выведения токсинов из организма, остановки кровотечений, лечения анемии, стабилизации артериального давления.

Исследования, проведенные на животных, показывают, что экстракт Red Brush замедляет развитие опухолей. Однако до сих пор нет подтвержденных данных об эффективности лечения рака у человека, поэтому не стоит надеяться, что Red Brush сможет заменить традиционные методы лечения таких заболеваний.

Но наибольшую известность Красная Кисть получила при лечении заболеваний женской сферы. В этом родиола похожа на другое популярное растение - Боровую матку. Кстати, оба растения можно использовать вместе при лечении женских болезней.В таком случае полезные вещества, содержащиеся в обоих представителях флоры, усиливают действие друг друга.

Как благотворно действует красная кисть? Наука не дает на это ответа. Но мы можем сделать предположение, что этот эффект ответственен за уникальное сочетание природных соединений в корне растения.
ОСНОВНЫЕ ФАРМАКОЛОГИЧЕСКИЕ КОМПОНЕНТЫ И ИХ СВОЙСТВА.

НАИМЕНОВАНИЕ СВОЙСТВА
Дубильные вещества Укрепляют стенки сосудов, вредны для паратифов, нормализуют функцию коры надпочечников и деятельность желудочно-кишечного тракта.
Гликозиды Стимулируют выработку энергии в клетках миокарда, контролируют процессы абсорбции, связь с белками, скорость растворения.
Эфирные масла Благотворно влияют на психическое и физическое здоровье, нормализуют работу нервной и эндокринной систем, восстанавливают водно-солевой баланс, выводят токсины из организма.
Органические кислоты Поддерживают кислотно-щелочной баланс (pH), способствуют регулярному опорожнению кишечника, его активной работе и усвоению многих необходимых питательных веществ, включая витамины и минералы.
Стерины Контролируют проницаемость клеточных мембран, влияют на обменные процессы, снижают уровень холестерина в крови, обладают выраженной антиоксидантной активностью, укрепляют иммунную систему.
Серебро Улучшает микрофлору, оказывает антибактериальное и ранозаживляющее действие, снижает температуру тела.
Молибден Поддерживает нормальное состояние тканей зубов, стимулирует активность ферментов, обеспечивающих синтез аскорбиновой кислоты и нормальное дыхание тканей.

Одним из важнейших компонентов является салидрозид - противовоспалительное и антибактериальное средство.
Антоцианы также обладают антисептическим действием.
Эфирные масла обладают антисептическим, ранозаживляющим, противовоспалительным действием.
Фенолы благоприятно влияют на сердечно-сосудистую систему, желудочно-кишечный тракт, обладают бактерицидным и бактерицидным действием.
Натуральные воски полезны для восстановления клеток и тканей.
Флавоноиды обладают мочегонным, ранозаживляющим и спазмолитическим действием.Стерины
способствуют выведению липопротеинов низкой плотности (плохого холестерина), предотвращают возникновение аутоиммунных заболеваний. Танины обладают противовоспалительным, ранозаживляющим и бактериостатическим действием. Органические кислоты активируют кроветворные процессы, укрепляют сосуды, улучшают обмен веществ, способствуют выведению токсинов из организма и снижают уровень липопротеинов низкой плотности. Немаловажную роль играют содержащиеся в растении микроэлементы.
Марганец принимает участие в кроветворении и синтезе инсулина, медь способствует выработке гемоглобина, цинк улучшает мозговые процессы, укрепляет кости.

Но, пожалуй, главным полезным компонентом Red Brush являются фитогормоны - природные аналоги женских гормонов. Они отвечают за стабилизацию гормонального фона организма женщины, что в конечном итоге приводит к излечению многих женских недугов.

Красная кисточка - отзывы о применении, противопоказания

Красная щетка имеет множество наименований, среди которых самыми популярными являются родиола четырехчленная, родиола четырехчастная и родиола четырехнадрезная. Это растение является одним из самых мощных стимуляторов и адаптогенов, известных в природе.Вы можете использовать его для омоложения организма, для его защиты и даже для остановки роста опухолевых клеток.

Относится к семейству Crassulaceae с красной кистью. Чаще всего это растение можно встретить в Горном Алтае.

Использование красной кисти

В химический состав растения входят антрагликозиды эфирного масла, белки, жиры, органические кислоты, третичные спирты, медь, кобальт, молибден, хром, марганец, воски, сахара, серебро, никель, дубильные вещества, гликозиды, флавоноиды, фенолы и цинк. стерины.

Одно из основных действующих веществ - гликозид салидрозид, при обработке которого красная щетка становится максимально эффективной. Препараты с содержанием растений обладают противовоспалительными, адаптогенными, противоинфекционными и онкопротекторными свойствами. Их можно использовать для устранения нарушений при гинекологических заболеваниях и заболеваниях надпочечников и щитовидной железы. Благодаря антицианам может быть достигнут лечебный или профилактический эффект грибковой, бактериальной и вирусной этимологии.

Красной щеткой можно бороться с мужскими и женскими заболеваниями, такими как бесплодие (как мужское, так и женское), ослабление потенции, нарушения менструального цикла, алигоспермия, аднексит, аменорея, эндометриоз, заболевания груди, поликистоз, эрозия шейки матки и многие другие. другие болезни.

С помощью растений можно справиться с множеством неприятных симптомов, возникающих во время климакса. Красная щетка, отзывы это подтверждают, может улучшить сон, успокоить.

Народные целители утверждают, что с его помощью можно лечить злокачественные и доброкачественные опухоли, а также лейкоз.Растение и содержащиеся в нем препараты широко применяются при аденоме простаты и простате. Также красная щетка помогает устранить самые разные эндокринные нарушения, такие как заболевания лимфатических узлов, надпочечников, почек, зоб и др. Обладает растительным и кровоостанавливающим действием.

По отзывам красная щетка обладает антибактериальным, противовоспалительным и противогрибковым действием. Народная медицина Алтая издавна рекомендует лечение красной кистью при гормональных нарушениях, а также для повышения иммунитета при тяжелых заболеваниях и в качестве профилактики.

Использование красной щетки обеспечивает омоложение тканей и органов. Однако многие лечебные свойства этого растения официальная медицина не признает. Но медики активно использовали его способность лечить сотрясение мозга, а также справляться с заживлением переломов.

Кисть красная применяется в виде настоек и отваров. Кроме того, он хорошо сочетается с множеством других трав.

Противопоказания к красной кисти

Категорически запрещается употреблять препараты с содержанием красной кисти людям, имеющим индивидуальную непереносимость какого-либо из компонентов растения, страдающим лихорадкой, имеющим проблемы с артериальным давлением.Противопоказания красная кисть и имеет сильное умственное возбуждение.

При передозировке могут появиться вялость и сонливость.

При приеме различных растительных гормонов и гормонов также запрещено использование средств из этого растения. Однако по отзывам, красная щетка в сочетании с боровой матки, которая, надо отметить, считается мощным фитогормоном, является достаточно сильным лекарством.

Сенсорные системы и реакции растений

Реакция растений на свет

Растения реагируют на световые раздражители ростом, дифференциацией, отслеживанием времени дня и времен года и движением к свету или от него.

Цели обучения

Сравните реакцию растений на свет

Основные выводы

Ключевые моменты
  • Растения растут и дифференцируются, чтобы оптимизировать свое пространство, используя свет в процессе, известном как фотоморфогенез.
  • Растения растут и движутся к свету или от него в зависимости от своих потребностей; этот процесс известен как фототропизм.
  • Фотопериодизм иллюстрируется тем, как растения цветут и растут в определенное время дня или года с помощью фоторецепторов, которые воспринимают длины волн солнечного света, доступные в течение дня (по сравнению с ночью) и в любое время года.
  • Различные длины волн света, красные / дальние красные или синие области видимого спектра света, вызывают структурные реакции у растений, подходящих для реакции на эти длины волн.
Ключевые термины
  • фоторецептор : специализированный белок, который способен обнаруживать свет и реагировать на него
  • фотопериодизм : рост, развитие и другие реакции растений и животных в зависимости от продолжительности дня и / или ночи
  • фотоморфогенез : регулирующее влияние света на рост, развитие и дифференциацию растительных клеток, тканей и органов
  • фототропизм : движение растения к свету или от него

Реакция растений на свет

У растений есть множество сложных способов использования света, которые выходят далеко за рамки их способности осуществлять фотосинтез.Растения могут дифференцироваться и развиваться в ответ на свет (известный как фотоморфогенез), что позволяет растениям оптимизировать использование света и пространства. Растения используют свет для отслеживания времени, что называется фотопериодизмом. Они могут определять время дня и года, ощущая и используя солнечные лучи различной длины. Свет также может вызывать у растений направленную реакцию, которая позволяет им расти навстречу свету или даже от него; это известно как фототропизм.

Фототропизм растения орхидеи : Это растение орхидеи, помещенное рядом с окном, растет навстречу солнечному свету через окно.Это пример позитивного фототропизма.

Чувство света в окружающей среде важно для растений; это может иметь решающее значение для конкуренции и выживания. Реакция растений на свет опосредуется различными фоторецепторами: белком, ковалентно связанным со светопоглощающим пигментом, называемым хромофором; вместе, называется хромопротеином. Хромофор фоторецептора поглощает свет определенной длины волны, вызывая структурные изменения в белке фоторецептора. Затем структурные изменения вызывают каскад передачи сигналов по всему растению.

Красная, дальняя красная и фиолетово-синяя области видимого спектра света запускают структурное развитие растений. Сенсорные фоторецепторы поглощают свет в этих конкретных областях видимого спектра света из-за качества света, доступного в дневном спектре. В наземных местообитаниях пики поглощения света хлорофиллами находятся в синей и красной областях спектра. По мере того, как свет фильтруется через навес и поглощаются синие и красные длины волн, спектр смещается к дальнему красному концу, смещая растительное сообщество к тем растениям, которые лучше приспособлены к реакции на дальний красный свет.Рецепторы синего света позволяют растениям определять направление и количество солнечного света, который богат сине-зелеными выбросами. Вода поглощает красный свет, поэтому обнаружение синего света необходимо для водорослей и водных растений.

Фитохромная система и реакция на красный свет

Растения используют фитохромную систему, чтобы определять уровень, интенсивность, продолжительность и цвет окружающего света для корректировки своей физиологии.

Цели обучения

Объясните реакцию фитохромной системы на красный / дальний красный свет

Основные выводы

Ключевые моменты
  • Воздействие красного света превращает хромопротеин в функциональную активную форму (Pfr), в то время как темнота или воздействие дальнего красного света превращает хромофор в неактивную форму (Pr).
  • Растения растут навстречу солнечному свету, потому что красный свет солнца превращает хромопротеин в активную форму (Pfr), которая запускает рост растений; растения в тени замедляют рост, потому что вырабатывается неактивная форма (Pr).
  • Если семена чувствуют свет с помощью системы фитохромов, они прорастут.
  • Растения регулируют фотопериодизм, измеряя соотношение Pfr / Pr на рассвете, что затем стимулирует физиологические процессы, такие как цветение, завязывание зимних почек и вегетативный рост.
Ключевые термины
  • фитохром : любой из класса пигментов, контролирующих большинство фотоморфогенных реакций у высших растений
  • хромофор : группа атомов в молекуле, в которой находится электронный переход, ответственный за данную спектральную полосу
  • фотопериодизм : рост, развитие и другие реакции растений и животных в зависимости от продолжительности дня и / или ночи

Фитохромная система и реакция красный / дальний-красный

Фитохромы представляют собой семейство хромопротеинов с линейным тетрапиррольным хромофором, аналогичным кольцевой тетрапиррольной светопоглощающей головной группе хлорофилла.Фитохромы имеют две фото-взаимопревращаемые формы: Pr и Pfr. Pr поглощает красный свет (~ 667 нм) и сразу преобразуется в Pfr. Pfr поглощает дальний красный свет (~ 730 нм) и быстро преобразуется обратно в Pr. Поглощение красного или дальнего красного света вызывает массивное изменение формы хромофора, изменяя конформацию и активность белка фитохрома, с которым он связан. Pfr - физиологически активная форма белка; Воздействие красного света вызывает физиологическую активность растения.Воздействие дальнего красного света превращает Pfr в неактивную форму Pr, подавляя активность фитохрома. Вместе эти две формы представляют собой фитохромную систему.

Фитохромная система : Биологически неактивная форма фитохрома (Pr) превращается в биологически активную форму Pfr при освещении красным светом. Дальний красный свет и темнота переводят молекулу обратно в неактивную форму.

Фитохромная система действует как биологический выключатель света. Он контролирует уровень, интенсивность, продолжительность и цвет окружающего света.Эффект красного света обратим, если на образец сразу же направить дальний красный свет, который преобразует хромопротеин в неактивную форму Pr. Кроме того, Pfr может медленно превращаться в Pr в темноте или со временем выходить из строя. Во всех случаях физиологическая реакция, вызванная красным светом, обратная. Активная форма фитохрома (Pfr) может напрямую активировать другие молекулы в цитоплазме или может быть доставлена ​​в ядро, где напрямую активирует или подавляет экспрессию определенных генов.

Фитохромная система и рост

Растения используют фитохромную систему, чтобы расти от тени к свету. Нефильтрованный, полный солнечный свет содержит намного больше красного света, чем дальний красный свет. Любое растение, находящееся в тени другого растения, будет подвергаться воздействию обедненного красным светом, обогащенного дальним красным светом, потому что другое растение поглотило большую часть другого красного света. Воздействие красного света превращает фитохром в затемненных листьях в форму Pr (неактивную), что замедляет рост. На ярком солнечном свете листья подвергаются воздействию красного света и активируют Pfr, который вызывает рост в сторону залитых солнцем участков.Поскольку конкуренция за свет настолько жестока в густом сообществе растений, те растения, которые могли расти к свету быстрее и эффективнее, становились наиболее успешными.

Фитохромная система в семенах

В семенах фитохромная система используется для определения наличия или отсутствия света, а не качества. Это особенно важно для видов с очень мелкими семенами и, следовательно, с запасами пищи. Например, если проростки салата прорастут на сантиметр под поверхностью почвы, росток истощит свои пищевые ресурсы и погибнет, не достигнув поверхности.Семена прорастают только при воздействии света на поверхность почвы, в результате чего Pr превращается в Pfr, что сигнализирует о начале прорастания. В темноте фитохром находится в неактивной форме Pr, поэтому семена не прорастут.

Фотопериодизм

Растения также используют фитохромную систему для регулирования роста в зависимости от времени года. Фотопериодизм - это биологический ответ на время и продолжительность темных и светлых периодов. Поскольку нефильтрованный солнечный свет богат красным светом, но не имеет дальнего красного света, на рассвете все молекулы фитохрома в листе превращаются в активную форму Pfr и остаются в этой форме до заката.Поскольку Pfr возвращается к Pr в темноте, на восходе солнца не будет Pfr, если ночь длинная (зима), и некоторое количество Pfr, если ночь будет короткой (лето). Количество присутствующего Pfr стимулирует цветение, завязывание зимних бутонов и вегетативный рост в зависимости от времени года.

Кроме того, фитохромная система позволяет растениям сравнивать продолжительность темных периодов в течение нескольких дней. Укороченные ночи указывают на весну для растения; удлинение ночи указывает на осень. Эта информация, наряду с измерением температуры и наличия воды, позволяет растениям определять время года и соответствующим образом корректировать свою физиологию.Растения с коротким днем ​​(долгой ночью) используют эту информацию для цветения в конце лета и ранней осенью, когда продолжительность ночи превышает критическую (часто восемь или меньше часов). Растения с длинным днем ​​(короткой ночью) цветут весной, когда темнота меньше критической длины (часто от 8 до 15 часов). Однако дневно-нейтральные растения не регулируют цветение по длине светового дня. Не все растения используют систему фитохромов для адаптации своих физиологических реакций к сезонам.

Ответ на синий свет

Рецепторы на основе белков, фототропины и криптохромы воспринимают синий свет, соответственно изменяя физиологию растений.

Цели обучения

Различать ответы растений на синий свет

Основные выводы

Ключевые моменты
  • Помимо фототропизма, фототропины воспринимают синий свет, чтобы контролировать открытие и закрытие листьев, движение хлоропластов и открытие устьиц.
  • Когда фототропины активируются синим светом, гормон ауксин накапливается на затемненной стороне растения, вызывая удлинение стволовых клеток и фототропизм.
  • Криптохромы воспринимают окислительно-восстановительные реакции, зависящие от синего света, чтобы контролировать циркадный ритм растений.
Ключевые термины
  • скототропизм : рост или движение вдали от света
  • фототропин : любой из класса фоторецепторных флавопротеидов, которые опосредуют фототропизм у высших растений
  • ауксин : класс гормонов роста растений, который отвечает за удлинение при фототропизме и гравитропизме, а также за другие процессы роста в жизненном цикле растений
  • криптохром : любой из нескольких светочувствительных флавопротеинов в проторецепторах растений, которые регулируют прорастание, удлинение и фотопериодизм

Ответы синего света

Фототропизм - это направленное наклонение растения к источнику света с синими длинами волн или от него.Положительный фототропизм - это рост по направлению к источнику света, а отрицательный фототропизм (также называемый скототропизмом) - это рост вдали от света. Некоторые белки используют синий свет для управления различными физиологическими процессами в растении.

Реакция голубого света на голубой свет : Лазурное обозрение (Houstonia caerulea) показывает фототропный отклик, наклоняясь к свету.

Фототропины и физиологические реакции

Фототропины - это рецепторы на основе белков, ответственные за опосредование фототропного ответа у растений.Как и все фоторецепторы растений, фототропины состоят из белковой части и светопоглощающей части, называемой хромофором, который воспринимает волны синего света. Фототропины принадлежат к классу белков, называемых флавопротеинами, потому что хромофор представляет собой ковалентно связанную молекулу флавина.

Фототропины контролируют другие физиологические реакции, включая открытие и закрытие листьев, движение хлоропластов и открытие устьиц. Однако из всех реакций, контролируемых фототропинами, фототропизм изучался дольше всего и лучше всего изучен.

Фототропизм и ауксин

В 1880 году Чарльз Дарвин и его сын Фрэнсис впервые описали фототропизм как склонение проростков к свету. Дарвин заметил, что свет воспринимается апикальной меристемой (верхушкой растения), но в ответ растение изгибается в другой части растения. Дарвины пришли к выводу, что сигнал должен идти от апикальной меристемы к основанию растения, где он изгибается.

В 1913 году Питер Бойзен-Йенсен провел эксперимент, который продемонстрировал, что химический сигнал, производимый кончиком растения, отвечает за реакцию растения на изгиб в основании.Он отрезал кончик саженца, покрыл срезанный слой проницаемым слоем желатина, а затем заменил кончик. При освещении саженец наклонялся к свету, хотя слой желатина присутствовал. Однако при вставке непроницаемых хлопьев слюды между кончиком и основанием среза саженец не сгибался.

Уточнение эксперимента Бойзена-Йенсена показало, что сигнал распространялся по затемненной стороне саженца. Когда пластинка слюды была вставлена ​​на освещенную сторону, растение все еще наклонялось к свету.Следовательно, химический сигнал от солнечного света, который представляет собой синие волны света, был стимулятором роста; фототропный ответ включал более быстрое удлинение клеток на заштрихованной стороне, чем на освещенной стороне, в результате чего растение изгибалось. Теперь мы знаем, что когда свет проходит через стебель растения, он дифрагирует и генерирует активацию фототропина через стебель. Большая часть активации происходит на освещенной стороне, в результате чего растительные гормоны индолуксусная кислота (ИУК) или ауксин накапливаются на затемненной стороне.Стволовые клетки удлиняются под действием ИУК.

Фототропизм и распределение ауксина : Фототропизм - это рост растений в ответ на свет. Когда солнце расположено почти прямо над растением, гормон ауксин (розовые точки) в стебле растения распределяется равномерно. Когда солнце движется, ауксин перемещается на другую сторону растения. Этот избыток ауксина рядом с этими клетками заставляет их начать расти или удлиняться, наклоняя рост стебля к свету.

Криптохромы

Криптохромы - это еще один класс фоторецепторов, поглощающих синий свет. Их хромофоры также содержат хромофор на основе флавина. Криптохромы задают циркадный ритм растения (24-часовой цикл активности) с помощью рецепторов синего света. Есть некоторые свидетельства того, что криптохромы работают, воспринимая светозависимые окислительно-восстановительные реакции и что вместе с фототропинами они опосредуют фототропную реакцию.

Реакция растений на гравитацию

Побеги растений растут вдали от силы тяжести к солнечному свету, а корни растений врастают в почву в направлении силы тяжести.

Цели обучения

Опишите роль амилопластов в гравитропизме

Основные выводы

Ключевые моменты
  • Положительный гравитропизм возникает, когда корни врастают в почву, потому что они растут в направлении силы тяжести, а отрицательный гравитропизм возникает, когда побеги растут навстречу солнечному свету в противоположном направлении силы тяжести.
  • Амилопласты оседают на дне клеток побегов и корней под действием силы тяжести, вызывая передачу сигналов кальция и высвобождение индолуксусной кислоты.
  • Индолуксусная кислота подавляет удлинение клеток в нижней части корней, но стимулирует рост клеток в побегах, что приводит к росту побегов вверх.
Ключевые термины
  • амилопласт : непигментированная органелла, обнаруженная в некоторых растительных клетках, которая отвечает за синтез и хранение гранул крахмала посредством полимеризации глюкозы
  • статолит : специализированная форма амилопласта, участвующая в гравиперцепции корнями растений и большинством беспозвоночных
  • гравитропизм : способность растения изменять свой рост в ответ на силу тяжести

Реакция растений на гравитацию

Прорастают ли они на свету или в полной темноте, побеги обычно прорастают из земли, а корни уходят в землю.Уложенное на бок в темноте растение направит побеги вверх, если дать ему достаточно времени. Гравитропизм обеспечивает прорастание корней в почву и рост побегов к солнечному свету. Рост вершины побега вверх называется отрицательным гравитропизмом, а рост корней вниз - положительным гравитропизмом.

Покадровая съемка роста побегов и корней гороха : Покадровая съемка растения гороха, растущего из семян, показывающая как побеги, так и корневую систему.Корни растут вниз в направлении силы тяжести, что является положительным гравитропизмом, а побеги растут вверх в направлении от силы тяжести, что является отрицательным гравитропизмом.

Причина, по которой растения знают, в каком направлении расти под действием силы тяжести, - это амилопласты в растениях. Амилопласты (также известные как статолиты) - это специализированные пластиды, которые содержат гранулы крахмала и оседают вниз под действием силы тяжести. Амилопласты находятся в побегах и в специализированных клетках корневого чехлика. Когда растение наклоняется, статолиты падают на новую нижнюю стенку клетки.Через несколько часов побег или корень покажут рост в новом вертикальном направлении.

Гравитропизм : Это изображение вертикального дерева с большой кривизной у основания в результате отрицательного гравитропизма. Несмотря на наклон, амилопласты вызывают рост побега в вертикальном направлении.

Механизм, обеспечивающий гравитропизм, достаточно хорошо изучен. Когда амилопласты оседают на дно чувствительных к гравитации клеток в корне или побеге, они физически контактируют с эндоплазматической сетью (ER).Это вызывает высвобождение ионов кальция изнутри ER. Эта кальциевая передача сигналов в клетках вызывает полярный транспорт растительного гормона индолуксусной кислоты (ИУК) на дно клетки. В корнях высокая концентрация ИУК препятствует удлинению клеток. Эффект замедляет рост нижней части корня, в то время как клетки развиваются нормально на верхней стороне. ИУК оказывает противоположный эффект на побеги, где более высокая концентрация в нижней части побега стимулирует рост клеток и заставляет побеги расти.После того, как побег или корень начинают расти вертикально, амилопласты возвращаются в свое нормальное положение. Другие гипотезы, которые вовлекают всю клетку в эффект гравитропизма, были предложены для объяснения того, почему некоторые мутанты, у которых отсутствуют амилопласты, могут все еще проявлять слабый гравитропный ответ.

Ауксины, цитокинины и гиббереллины

На все физиологические аспекты растений влияют гормоны растений (химические посредники), включая ауксины, цитокинины и гиббереллины.

Цели обучения

Различать типы гормонов растений и их влияние на рост растений

Основные выводы

Ключевые моменты
  • Во время фототропизма и гравитропизма растительный гормон ауксин контролирует удлинение клеток.
  • Растительный гормон цитокинин способствует делению клеток, контролируя многие процессы развития растений.
  • Гиббереллины контролируют многие аспекты физиологии растений, включая удлинение побегов, прорастание семян, созревание плодов и цветов, покой семян, гендерное выражение, развитие плодов без косточек и задержку старения листьев и плодов.
Ключевые термины
  • гиббереллин : любой из класса дитерпеновых гормонов роста растений, которые стимулируют удлинение побегов, прорастание семян и созревание плодов и цветов
  • ауксин : класс гормонов роста растений, который отвечает за удлинение при фототропизме и гравитропизме, а также за другие процессы роста в жизненном цикле растений
  • цитокинин : любой из классов растительных гормонов, участвующих в росте и делении клеток

Реакция роста

Сенсорная реакция растения на внешние раздражители зависит от гормонов, которые являются просто химическими посредниками.Гормоны растений влияют на все аспекты жизни растений, от цветения до завязывания и созревания плодов, от фототропизма до опадания листьев. Потенциально каждая клетка растения может вырабатывать гормоны растения. Гормоны могут действовать в своей исходной клетке или транспортироваться в другие части тела растения, при этом многие реакции растений включают синергетическое или антагонистическое взаимодействие двух или более гормонов. Напротив, гормоны животных вырабатываются в определенных железах и транспортируются в отдаленное место для действия, действуя в одиночку.

Гормоны растений - это группа не связанных между собой химических веществ, влияющих на морфогенез растений. Традиционно описываются пять основных гормонов растений: ауксины, цитокинины, гиббереллины, этилен и абсцизовая кислота. Кроме того, другие питательные вещества и условия окружающей среды можно охарактеризовать как факторы роста. Первые три гормона растений в значительной степени влияют на рост растений, как описано ниже.

Ауксины

Термин «ауксин» происходит от греческого слова auxein, что означает «расти».«Ауксины - главные гормоны, ответственные за удлинение клеток при фототропизме и гравитропизме. Они также контролируют дифференцировку меристемы в сосудистую ткань и способствуют развитию и расположению листьев. Хотя многие синтетические ауксины используются в качестве гербицидов, индолуксусная кислота (ИУК) является единственным естественным ауксином, который проявляет физиологическую активность. Апикальное доминирование (ингибирование образования боковых зачатков) запускается ауксинами, продуцируемыми в апикальной меристеме. Цветение, завязывание и созревание плодов, а также ингибирование опадания (опадания листьев) - это другие реакции растений, находящиеся под прямым или косвенным контролем ауксинов.Ауксины также действуют как реле для эффектов синего света и красных / дальних красных ответов.

Коммерческое использование ауксинов широко распространено в питомниках растений и в растениеводстве. ИУК используется в качестве гормона укоренения, способствующего росту придаточных корней черенков и отслоившихся листьев. Применение синтетических ауксинов к растениям томатов в теплицах способствует нормальному развитию плодов. Применение ауксина на открытом воздухе способствует синхронизации завязывания и опадания плодов, что координирует сезон сбора урожая.У таких фруктов, как огурцы без косточек, можно вызвать завязывание плодов путем обработки неоплодотворенных цветков растений ауксинами.

Цитокинины

О влиянии цитокининов впервые сообщили, когда было обнаружено, что добавление жидкого эндосперма кокосовых орехов к развивающимся в культуре зародышам растений стимулировало их рост. Стимулирующим фактором роста оказался цитокинин, гормон, который способствует цитокинезу (делению клеток). На сегодняшний день известно почти 200 природных или синтетических цитокининов.Цитокинины наиболее распространены в растущих тканях, таких как корни, эмбрионы и плоды, где происходит деление клеток. Известно, что цитокинины задерживают старение в тканях листа, способствуют митозу и стимулируют дифференцировку меристемы в побегах и корнях. Многие эффекты на развитие растений находятся под влиянием цитокининов в сочетании с ауксином или другим гормоном. Например, апикальное доминирование, по-видимому, является результатом баланса между ауксинами, которые ингибируют боковые зачатки, и цитокининами, которые способствуют более густому росту.

Гиббереллины

Гиббереллины (ГА) представляют собой группу из 125 близкородственных гормонов растений, которые стимулируют удлинение побегов, прорастание семян и созревание плодов и цветов. ГК синтезируются в апикальных меристемах корня и стебля, молодых листьях и зародышах семян. В городских районах антагонисты GA иногда наносят на деревья под линиями электропередач для контроля роста и уменьшения частоты обрезки.

GA нарушают покой (состояние подавления роста и развития) семян растений, которым для прорастания требуется воздействие холода или света.Абсцизовая кислота - сильный антагонист действия ГА. Другие эффекты ГА включают выражение пола, развитие плодов без косточек и задержку старения листьев и плодов. Виноград без косточек получают стандартными методами селекции; они содержат незаметные семена, которые не развиваются. Поскольку ГА продуцируются семенами, а развитие плодов и удлинение стебля находятся под контролем ГА, эти сорта винограда обычно дают небольшие плоды в компактных гроздьях. Созревающий виноград обычно обрабатывают GA для увеличения размера плодов, а также для получения более рыхлых гроздей (более длинные стебли), что снижает вероятность заражения плесенью.

Влияние гиббереллинов на виноград : Применение гиббереллиновой кислоты в винограде увеличивает размер плодов и разрыхляет их гроздья.

Абсцизовая кислота, этилен и нетрадиционные гормоны

Все физиологические аспекты растений зависят от растительных гормонов, включая абсцизовую кислоту, этилен и нетрадиционные гормоны.

Цели обучения

Опишите роль этилена и нетрадиционных гормонов в развитии растений

Основные выводы

Ключевые моменты
  • При стрессе абсцизовая кислота накапливается в растениях, подавляя удлинение стебля и вызывая покой почек.
  • Растительный гормон этилен контролирует созревание плодов, увядание цветов и опадание листьев, стимулируя превращение крахмала и кислот в сахара.
  • Другие нетрадиционные гормоны, такие как жасмонаты и олигосахарины, контролируют защитные реакции от травоядных и бактериальных / грибковых инфекций соответственно.
Ключевые термины
  • абсцизовая кислота : растительный гормон, который участвует во многих процессах развития растений, включая покой почек, ингибирование прорастания семян и устойчивость растений к стрессу.
  • жасмонат : любой из нескольких сложных эфиров жасмоновой кислоты, которые действуют как гормоны растений
  • этилен : растительный гормон, участвующий в созревании плодов, увядании цветов и опадании листьев

Реакция роста

В дополнение к ауксинам, цитокининам и гиббереллинам гормонов роста существуют еще два основных типа растительных гормонов, абсцизовая кислота и этилен, а также несколько других менее изученных соединений, которые контролируют физиологию растений.

Абсцизовая кислота

Растительный гормон абсцизовая кислота (ABA) был впервые обнаружен как агент, вызывающий опадение или опадание коробочек хлопка. Однако более поздние исследования показывают, что АБК играет лишь незначительную роль в процессе опадения. АБК накапливается в ответ на стрессовые условия окружающей среды, такие как обезвоживание, низкие температуры или сокращение продолжительности дня. Его активность противодействует многим стимулирующим рост эффектам ГА и ауксинов. АБК подавляет удлинение стебля и вызывает покой боковых почек.

ABA вызывает покой семян, блокируя прорастание и способствуя синтезу запасных белков. Растения, адаптированные к умеренному климату, требуют длительного периода низких температур, прежде чем семена прорастут. Этот механизм предохраняет молодые растения от слишком раннего прорастания зимой в не по сезону теплой погоде. Поскольку гормон постепенно разрушается в течение зимы, семена выходят из состояния покоя и прорастают при благоприятных весенних условиях. Другой эффект АБК - способствовать развитию зимних почек; он опосредует превращение апикальной меристемы в спящую почку.Низкая влажность почвы вызывает увеличение АБК, что приводит к закрытию устьиц, уменьшая потерю воды зимними почками.

Этилен

Этилен связан с созреванием плодов, увяданием цветов и опаданием листьев. Этилен необычен, потому что это летучий газ (C 2 H 4 ). Сотни лет назад, когда на городских улицах были установлены газовые уличные фонари, деревья, росшие рядом с фонарными столбами, имели скрученные утолщенные стволы, сбрасывающие листья раньше, чем ожидалось.Эти эффекты были вызваны улетучиванием этилена из ламп.

Стареющие ткани (особенно стареющие листья) и узлы стеблей вырабатывают этилен. Однако наиболее известным эффектом гормона является ускорение созревания плодов. Этилен стимулирует превращение крахмала и кислот в сахара. Некоторые люди хранят незрелые фрукты, такие как авокадо, в запечатанных бумажных пакетах, чтобы ускорить созревание; Газ, выделяемый первым созревшим плодом, ускоряет созревание оставшихся плодов.Этилен также вызывает опадение листьев и плодов, увядание и опадание цветов, а также способствует прорастанию некоторых злаков и прорастанию луковиц и картофеля.

Дата созревания : Растительный гормон этилен способствует созреванию, что проявляется в созревании фиников.

Этилен широко используется в сельском хозяйстве. Коммерческие садоводы контролируют время созревания плодов с помощью газа. Садоводы препятствуют опаданию листьев у декоративных растений, удаляя этилен из теплиц с помощью вентиляторов и вентиляции.

Нетрадиционные гормоны

Недавние исследования обнаружили ряд соединений, которые также влияют на развитие растений. Их роль менее понятна, чем действие основных гормонов, описанных до сих пор.

Жасмонаты играют важную роль в защите от травоядных животных. Их уровни повышаются, когда растение ранено хищником, что приводит к увеличению токсичных вторичных метаболитов. Они способствуют производству летучих соединений, привлекающих естественных врагов хищников.Например, жевание гусеницами томатов приводит к увеличению уровня жасмоновой кислоты, что, в свою очередь, вызывает выброс летучих соединений, привлекающих хищников-вредителей.

Олигосахарины также играют роль в защите растений от бактериальных и грибковых инфекций. Они действуют локально на месте травмы; они также могут переноситься в другие ткани. Стриголактоны способствуют прорастанию семян у некоторых видов и подавляют латеральное апикальное развитие в отсутствие ауксинов.Стриголактоны также играют роль в создании микоризы, мутуалистической ассоциации корней растений и грибов. Брассиностероиды важны для многих процессов развития и физиологических процессов. Сигналы между этими соединениями и другими гормонами, особенно ауксином и ГА, усиливают их физиологический эффект. На верхушечное доминирование, прорастание семян, гравитропизм и устойчивость к замораживанию положительно влияют гормоны. Стероиды подавляют рост корней и опадание плодов.

Реакция растений на ветер и прикосновение

Растения реагируют на ветер и прикосновения изменением направления роста, движения и формы.

Цели обучения

Сравните способы реакции растений на направленные и ненаправленные раздражители

Основные выводы

Ключевые моменты
  • Под воздействием постоянного направленного давления, такого как решетка, растения перемещаются, чтобы расти вокруг объекта, создавая давление; этот процесс известен как тигмотропизм.
  • Тигмонастические реакции включают открывание и закрывание листьев, лепестков или других частей растения как реакцию на прикосновение.
  • Посредством тигмоморфогенеза растения изменяют свой рост в ответ на повторяющееся механическое воздействие ветра, дождя или других живых существ.
Ключевые термины
  • тигмотропизм : рост или движение растений в ответ на прикосновение
  • thigmomorphogenesis : реакция растений на механическое ощущение (прикосновение) путем изменения модели их роста
  • thigmonastic response : сенсорный ответ, независимый от направления стимула

Реакция растений на ветер и прикосновение

Побег гороха обвивается вокруг решетки, а дерево растет под углом в ответ на сильные ветры.Это примеры того, как растения реагируют на прикосновение или ветер.

Движение растения, находящегося под постоянным направленным давлением, называется тигмотропизмом, от греческих слов thigma, означающих «прикосновение», и тропизм, подразумевающих «направление». Щупальца - один из примеров этого. Усик - это особый стебель, лист или черешок нитевидной формы, который используется вьющимися растениями в качестве опоры. Меристематическая область усиков очень чувствительна к прикосновениям; легкое прикосновение вызовет быструю реакцию свертывания.Клетки, контактирующие с опорной поверхностью, сжимаются, тогда как клетки на противоположной стороне опоры расширяются. Достаточно применения жасмоновой кислоты, чтобы вызвать скручивание усиков без механического воздействия.

Тигмотропизм у красной лозы : Усики красной лозы вырабатывают ауксин в ответ на прикосновение к опорной палочке, а затем переносят ауксин в клетки, не дотрагивающиеся до них. Не соприкасающиеся клетки удлиняются быстрее и обвиваются вокруг опорной палочки.

Тигмонастическая реакция - это реакция на прикосновение, не зависящая от направления стимула.В мухоловке Venus два модифицированных листа соединены шарниром и выстланы тонкими вилкообразными зубцами по внешним краям. Внутри ловушки находятся крошечные волоски. Когда насекомое касается этих триггерных волосков, последовательно касаясь двух или более из них, листья быстро закрываются, захватывая добычу. Железы на поверхности листа выделяют ферменты, которые медленно переваривают насекомое. Высвободившиеся питательные вещества усваиваются листьями, которые снова открываются для следующего приема пищи.

Тигмоморфогенез - это медленное изменение формы растения, подвергающегося постоянному механическому воздействию, в процессе развития.Например, когда деревья гнутся на ветру, рост обычно замедляется, а ствол утолщается. Укрепление тканей, особенно ксилемы, способствует увеличению жесткости, чтобы противостоять силе ветра. Исследователи предполагают, что механическое напряжение от ветра, дождя или движения других живых существ вызывает рост и дифференциацию для укрепления тканей. Этилен и жасмонат, вероятно, участвуют в тигмоморфогенезе.

Мочевыделительная система: Руководство по гистологии

После выхода из почечного тельца фильтрат проходит через почечный каналец в следующем порядке, как показано на диаграмме:

  1. проксимальный извитый канальец (красный: обнаружен в коре почек)
  2. петля Генле (синяя: в основном в мозговом веществе)
  3. дистальный извитый каналец (фиолетовый: обнаружен в коре почек)
  4. собирательный каналец (черный: в мозговом веществе)
  5. собирательный канал черный: (в мозговом веществе)

Форма и структура поперечного сечения различных частей канальцев различаются в зависимости от их функций.

Во-первых, проксимальный извитый каналец , который является самой длинной частью почечного канальца, имеет простую высокую кубовидную форму. эпителий, с щеточной каймой (микроворсинки). Эпителий почти заполняет просвет, а микроворсинки увеличивают площадь поверхности в 30-40 раз.

Как вы думаете, для чего это нужно?

Во-вторых, петля Генле,

Он имеет толстую нисходящую часть (pars recta), тонкую нисходящую часть, тонкую восходящую часть и толстую восходящую часть.

Просвет состоит из простых плоскоклеточных эпителий.

Эту часть нефрона трудно отличить от соседних капилляров, за исключением того, что в просвете нет эритроцитов.

Наконец, дистальный извитый каналец .

Эти канальцы менее многочисленны, чем проксимальные извитые канальцы. Эпителиальные клетки кубовидной формы с очень небольшим количеством микроворсинок. Клетки окрашиваются более бледно, чем клетки проксимального извитого канальца.Щелкните здесь, чтобы увидеть EM DCT.

Собирающие канальцы не являются частью нефрона.

Эпителий этих канальцев состоит из кубовидных или столбчатых клеток. Они впадают в собирательные протоки, которые легко распознать, потому что они имеют большие просветы с бледным столбчатым эпителием.

Сборные канальцы выполняют две основные функции:

1. Резорбирует воду в ответ на гормон вазопрессин .

2.резорбирует натрий в ответ на гормон альдостерон .

Из этих описаний попытайтесь найти почечных тельцов , проксимальных
и дистальных извитых канальцев и петель Генле
в этом срезе коры головного мозга почек с помощью электронного микроскопа.

Переключить метки

Это изображение также можно просмотреть с помощью программы просмотра Zoomify.

5 трав для баланса гормонов

В настоящее время большой процент женщин может испытывать гормональный дисбаланс, от ПМС до симптомов, связанных с менопаузой.В последние годы люди стали более строго обсуждать эту тему: менструальные боли, симптомы, связанные с предменструальным синдромом, и т. Д. Теперь мы знаем, что менструальный цикл не должен болеть, и что если это произойдет, то вполне возможно, что у нас будет избыток менструального цикла. эстрогены в нашем организме или дисбаланс между прогестероном и эстрогенами, например. Мы также знаем, что диета и образ жизни значительно влияют на нашу гормональную систему, поэтому, хотя каждый случай индивидуален и требует индивидуального рассмотрения, сильное падение уровня эстрогена, которое женщины испытывают во время менопаузы, и все связанные с этим могут быть поддержаны путем введения большего количества фитоэстрогенов в наш рацион (учитывая отсутствие риска эстроген-зависимого рака груди).

Некоторые из симптомов, которые могут указывать на гормональный дисбаланс:

Вот 5 трав, которые помогают сбалансировать ваш гормональный фон:
1. Мака

Мака веками использовалась перуанцами для повышения фертильности, гормонального баланса, либидо и выносливости. Он не производит гормоны, а работает как адаптогенное растение, что означает, что он приспосабливается к обстоятельствам каждого организма и уравновешивает гормоны в зависимости от потребностей этого человека. Таким образом, если человек вырабатывает слишком много или слишком мало гормона, он будет действовать в противоположном направлении, либо увеличивая дефицит гормона, либо уменьшая выработку организмом избыточного гормона.Нам нравится называть это регулятором. Он регулирует гормоны и держит их под контролем, не позволяя им выйти из-под контроля.

Мака стимулирует и питает гипофиз и гипоталамус эндокринной системы, которые известны как «главные железы». Эти две железы отвечают за регулирование всех других желез, вырабатывающих гормоны. Когда эти «главные железы» находятся в равновесии, у него есть способность естественным образом приводить в равновесие и все другие железы. Это растение не только для женщин! Мужчины получают большую пользу от этой травы, и она часто может в разы повысить либидо и выносливость.Это натуральная «Виагра» всех сортов. Кроме того, поскольку 40-50 процентов случаев бесплодия частично вызваны мужчинами, прием этой травы может помочь с подвижностью, объемом и качеством сперматозоидов.

2. Лист красной малины

Обладает приятным вкусом чая и представляет собой богатую питательными веществами траву для женщин. Эта трава наиболее известна своими укрепляющими свойствами для матки. Эта замечательная трава является богатым источником витаминов и минералов, в частности витамина С. Лист красной малины имеет много преимуществ, помимо тонизирующего средства для матки.Известно, что он помогает повысить фертильность как у мужчин, так и у женщин, предотвратить выкидыш и кровотечение, а также уменьшить обильный кровоток и болезненные менструальные спазмы. Он может облегчить тошноту, связанную с беременностью, уменьшить боль во время и после родов и помочь стимулировать выработку молока.

3. Витекс Ор (Ягода целомудренного дерева)

Эта трава имеет долгую историю использования для регуляции гормонов. Его часто используют для лечения эндометриоза, бесплодия, ПМС, предотвращения выкидыша в первом триместре и симптомов менопаузы, особенно приливов.Витекс или целомудренная древесная ягода. Эта трава помогает регулировать менструальный цикл и даже помогает начать менструацию у женщин, у которых не было менструаций в течение некоторого времени. Витекс не содержит настоящих гормонов, а, скорее, помогает естественным образом сбалансировать гормоны организма, регулируя работу гипофиза, о котором мы говорили ранее и что он был одной из «главных желез» организма. Регулируя работу гипофиза, он влияет на функцию других желез, участвующих в этой системе. Гипофиз посылает сигнал другим железам, чтобы сказать им, когда и сколько гормона производить.Эта система коммуникации называется петлей гормональной обратной связи. Если гипофиз не сбалансирован должным образом, это эффективно нарушит баланс других желез.

4. Расторопша пятнистая

Это одна из самых любимых трав при множестве заболеваний. Расторопша пятнистая - одна из лучших трав для очищения печени, а здоровая печень жизненно важна для гормонального баланса. У многих женщин из-за этого наблюдается избыток эстрогена и дефицит прогестерона. Многие люди не знают, что избыток эстрогенов выводится из организма через печень.Если печень перегружена и застаивается, организм не может удалить эти избыточные эстрогены, и они снова попадают в организм. Печень также перерабатывает токсичные отходы нашего организма, такие как химические вещества, тяжелые металлы, грибки и другие токсины. Многие из этих токсинов могут имитировать гормоны в нашем организме и приводить к дальнейшему гормональному дисбалансу и нарушениям.

5. Овсяная солома

Овсяная солома может быть не той травой, которая приходит на ум, когда люди думают о травах, повышающих гормоны.Овсяная солома укрепляет нервы, успокаивает тело, укрепляет кровь, стабилизирует настроение, усиливает пищеварение, успокаивает желудок, уравновешивает эндокринную систему или железы, вырабатывающие гормоны, поддерживает скелетную систему из-за большого количества биодоступного кальция, магния и кремнезем и успокаивает центральную нервную систему. Другие полезные свойства этой красивой травы - это отличные поддерживающие свойства для волос, кожи и ногтей, мочегонное средство, снижение холестерина и здоровье сердца. Эта трава хороша сама по себе или в качестве основы в смеси с другими травами.

Натуральные ингредиенты для естественного баланса наших гормонов

В Vitae мы верим в улучшение самочувствия изнутри, работая с источниками дисфункции. Мы верим в здоровье и поэтому работаем с ингредиентами, которые уважают наше тело. Когда дело доходит до гормонального дисбаланса, есть ряд ингредиентов, которые могут быть очень полезными. Конечно, мы всегда под профессиональным наблюдением, чтобы подробно изучить наш случай и порекомендовать лучшие варианты.

Да, жиры полезны, и они должны быть частью нашего ежедневного рациона, особенно омега-3 и 6 жирные кислоты.Вы уже читали о преимуществах омега-3, но мы повторим их, потому что они очень важны. Одним из самых больших преимуществ, которые он имеет, является мощное противовоспалительное действие, которое также положительно влияет на наши когнитивные функции, здоровье сердечно-сосудистой системы, кожу и слизистые оболочки, среди прочего. При любом физиологическом дисбалансе часто возникает воспаление, и именно поэтому употребление омега-3 поможет нам держать эту проблему под контролем.

Омега-6 часто связывают с нездоровыми жирами, а именно с транс- и ультра-переработанными жирами.Даже в этом случае, употребленный в надлежащей мере и в сочетании с омега-3 в определенной пропорции, он может принести нам огромную пользу. Правильное соотношение омега-6 и 3 жирных кислот должно составлять от 1: 1 до 4: 1 соответственно. Проблема в том, что в большинстве диет содержится больше омега-6, чем омега-3.

Самыми полезными ингредиентами, богатыми жирными кислотами, являются синяя рыба (убедитесь, что она максимально органическая), чиа, лен, семена тыквы, грецкие орехи, водоросли, яйца, оливковое масло, кокос, авокадо, бобовые и соя (всегда едят в умеренных количествах и как можно меньше трансгенных).

  • Валериана, пассифлора и калифорнийский мак

Эти три ингредиента в сочетании друг с другом могут оказывать уникальное воздействие на наше здоровье. Важно напомнить, что они не создают зависимости или привыкания, то есть они уважительно относятся к нашему телу и приспосабливаются к нашей физиологии. Во-вторых, они помогут нам естественным образом регулировать стресс и тревогу и, как следствие, улучшить наш гормональный фон.

Кроме того, если нам трудно заснуть (прямой побочный эффект тревожных состояний), мы можем найти на рынке пищевые добавки на основе натуральных растений и мелатонина, который, хотя и является гормоном, и нам не следует злоупотреблять им, но он поможет. мы регулируем цикл сна и бодрствования естественным образом.

Как мы всегда говорим, берегите себя изнутри!

Мембрана щеточной каймы кишечника - обзор

ОНТОГЕННОСТЬ ПИЩЕВАРИТЕЛЬНОЙ ФУНКЦИИ

Уровни экспрессии пищеварительных ферментов в щеточной кайме тонкой кишки резко меняются от неонатального периода к взрослой жизни из-за диетической адаптации. Эта тема интенсивно исследуется с 1970-х годов. Дисахаридазы расположены в мембране щеточной каймы зрелых энтероцитов тонкой кишки.Основными дисахаридазами, обнаруженными у человека, являются ß-галактозидаза (лактаза) и α-глюкозидазы (сахароза, изомальтаза и глюкоамилаза). Лактаза гидролизует лактозу до глюкозы и галактозы. Сахараза гидролизует сахарозу до фруктозы и глюкозы. Изомальтаза гидролизует α-1, шесть связей α-предельных декстринов до двух единиц глюкозы. Мальтаза гидролизует мальтозу до двух единиц глюкозы. Дисахаридазная активность наиболее высока в проксимальном и среднем отделах черепа. Активность глюкоамилазы равномерно распределяется по тонкому кишечнику.Уровень лактазы продолжает увеличиваться на 30 см от связки Трейца, а затем снижается. Это распределение устанавливается в течение жизни плода и продолжается во взрослой жизни.

Молоко обогащено липидами, но содержит относительно низкий уровень углеводов. Лактоза - главный углевод в материнском молоке. Активность лактазы, которая достигает пика вскоре после рождения, является низкой до 12-й недели плода и увеличивается только до 30% от уровня перинатальной экспрессии к 26–34-й неделе беременности (50).Быстрое онтогенное изменение активности лактазы в кишечнике на раннем этапе жизни человека ясно демонстрирует физиологически значимую диетическую адаптацию после рождения. Уровни лактазы остаются относительно высокими в течение 6 месяцев, а затем снижаются к 5 годам (51). У взрослых существует два фенотипа в отношении переваривания лактозы. Для большей части населения мира характерна потеря активности лактазы до достижения зрелости, что приводит к гиполактазии взрослого типа. Следовательно, употребление продуктов, содержащих лактозу, приведет к диарее осмотического типа.Фенотип, устойчивый к лактазе, характеризуется постоянной высокой активностью лактазы в течение всего взрослого возраста. Гиполактазия взрослого типа наследуется рецессивным образом, тогда как сохранение активности лактазы наследуется доминантным образом. В промоторной области гена лактазы описано несколько нуклеотидных полиморфизмов. Два конкретных однонуклеотидных полиморфизма (SNP) тесно связаны с гиполактазией взрослого типа. C в положении-13910 выше гена лактазы ассоциирован на 100%, а G в положении-22018 более чем на 95% связан с непостоянством лактазы в финской популяции (52).Функциональная роль этих SNP подтверждена в двух статьях (53,54), демонстрирующих, что геномная область, содержащая эти два полиморфизма, обладает энхансерной активностью.

В настоящее время считается, что экспрессия лактазы как у людей, так и у животных регулируется сложным пространственным паттерном и паттерном развития в тонком кишечнике. Консервативный проксимальный промотор из 150 пар оснований (п.н.) важен для регуляции экспрессии лактазы. Эта промоторная область связывает факторы транскрипции, такие как CDX-2, ядерный фактор гепатоцитов 1a (HNF-1a) и GATA, которые важны для регуляции экспрессии лактазы.

У человека все глюкозидазы присутствуют к третьему внутриутробному месяцу. Повышение уровня мальтазы, глюкоамилазы и сахаразы-изомальтазы происходит на 12-й неделе беременности, а 70% уровней у взрослых достигаются между 26-й и 34-й неделями (50,55). Хотя эти изменения в развитии были хорошо задокументированы за последние несколько десятилетий, молекулярные механизмы того, как эти гены точно регулируются, остаются в значительной степени неизвестными, но были предложены механизмы транскрипции (56).Действительно, у мышей и в кишечнике крысы сахароза-изомальтаза увеличивается при отъеме, и было показано, что комбинаторная роль HNF-1a, Cdx-2 и GATA-4 участвует во времени и положении сахаразы-изомальтазы. экспрессия в тонком кишечнике (56).

Подобно нашему продвинутому пониманию молекулярной физиологии пищеварительных ферментов на кишечной щеточной кайме мембраны, мы достигли значительного прогресса в наших знаниях о событиях онтогенеза островков Лангерганса в поджелудочной железе млекопитающих.В частности, произошел резкий сдвиг от ранее существовавшей концепции одного секретируемого гормона на тип клетки в онтогенезе к более широкому принятию клетки-предшественника для каждого из четырех типов основных типов эндокринных клеток, которые в конечном итоге производят инсулин, глюкагон, соматостатин и полипептид поджелудочной железы (57). Современное понимание онтогенных изменений эндокринной поджелудочной железы состоит в том, что существует серия стадий дифференцировки островковых клеток, и на одной из этих стадий они часто могут секретировать более одного гормона (58).На ранних этапах развития секреция глюкагона и инсулина обычно опосредуется одной и той же клеткой (59). Соматостатин и полипептид поджелудочной железы секретируются вместе клетками намного позже в развитии, но в какой-то момент развития мыши полипептид YY присутствует во всех четырех основных типах островковых клеток (60).

Совсем недавно биологи развития продемонстрировали, что развитие поджелудочной железы требует сложных комбинаций факторов транскрипции для контроля органогенеза и дифференцировки клеток (61–63).В частности, семейство факторов транскрипции Pax участвует в формировании поджелудочной железы и многих других органов. Два его члена, Pax4 и Pax6 , играют важную роль в дифференцировке островков (64,65). Гены Pax кодируют ключевые регуляторы, которые участвуют в эмбриональном развитии многих органов, включая глаза, мозг, почки, щитовидную железу, иммунную систему и поджелудочную железу. Ряд генетических нарушений у мышей и людей связан с мутациями в специфических генах Pax . Pax гены 4 и 6 необходимы для развития поджелудочной железы мыши с Pax6 , управляющим дифференцировкой A-клеток (65). Pax4 нулевые мыши лишены серотонин и соматостатин-секретирующих клеток в антральном отделе желудка, а также большинства типов эндокринных клеток в проксимальном отделе тонкой кишки (66). Делеция Pax6 устраняет глюкагоноподобный пептид-1 (GLP-1) и GLP-2-экспрессирующие клетки в дистальном отделе кишечника (67), клетки гастрина и соматостатина в антральном отделе, а также желудочно-ингибирующий пептид (GIP) клетки двенадцатиперстной кишки (66).Кроме того, сниженное количество всех четырех типов клеток панкреатических островков наблюдалось у Pax6 нулевых мышей (62), а эндокринные клетки поджелудочной железы отсутствовали у мышей с двойным нокаутом Pax4 и Pax6 (65). Новый член семейства протеинтирозинфосфатаз (PTP), названный PTP-NP (для нервной и панкреатической), представляет собой трансмембранную молекулу рецепторного типа и ранний маркер развития (68). В целом, отсутствие этих типов эндокринных клеток у Pax4 и Pax6 нулевых мышей указывает на то, что Pax4 и Pax6 играют решающую роль в нормальном развитии поджелудочной железы.

Другой регуляторный пептид, адреномедуллин, модулирует секрецию инсулина (69). Адреномедуллин - это почти повсеместно экспрессируемый пептид, который участвует в росте, развитии и передаче эндокринных сигналов. Он экспрессируется островковыми клетками во время развития (70). Этот гормон сначала появляется в клетках, содержащих глюкагон, затем, в конечном итоге, во всех основных типах островковых клеток и в конечном итоге только в тех клетках, которые экспрессируют полипептид поджелудочной железы (71). Таким образом, ранняя экспрессия адреномедуллина имеет решающее значение для нормального развития островков.

Ген-1 гомеобокса двенадцатиперстной кишки поджелудочной железы (Pdx-1) является главным регулятором как развития поджелудочной железы, так и дифференцировки клеток-предшественников в фенотип β-клеток (72,73). Pdx1 регулирует экспрессию генов инсулина и соматостатина в эндокринной поджелудочной железе (74). Стабильная экспрессия Pdx-1 в секретирующей глюкагон клеточной линии достаточна для индукции экспрессии специфичных для β-клеток генов инсулина, глюкокиназы и островкового амилоидного полипептида (75,76).Паттерны экспрессии Pdx-1 в развивающейся поджелудочной железе сохраняются на протяжении всего развития и обеспечивают как пространственный, так и временной вклад в приверженность энтодермы панкреатическому фенотипу (77). Направленное нарушение гена Pdx-1 у мышей приводит к агенезу поджелудочной железы (78,79). Примечательно, что ребенок, рожденный без поджелудочной железы, оказался гомозиготным по инактивирующей мутации в Pdx-1 (80), что подчеркивает важность фактора транскрипции Pdx-1 в развитии поджелудочной железы.

Плацентарная экспрессия гормонов гипофиза является наследственной особенностью терианских млекопитающих

, 1 , 2 и 3

Брэндон Р. Мензис

1 Институт исследований зоопарка и дикой природы им. Str 17, 10315, Берлин, Германия

Эндрю Дж. Паск

2 Департамент молекулярной и клеточной биологии, Университет Коннектикута Сторрс, Китай, США

Мэрилин Б. Ренфри

3 Департамент зоологии Университета Мельбурн, 3010, Виктория, Австралия

1 Институт зоопарков и диких животных им. Лейбница, Alfred-Kowalke-Str 17, 10315, Берлин, Германия

2 Департамент молекулярной и клеточной биологии, Университет Коннектикута Сторрс, Китай , США

3 Зоологический факультет Мельбурнского университета, 3010, Виктория, Австралия

Автор, ответственный за переписку.

Поступило 2 июня 2011 г .; Принято 19 августа 2011 г.

Copyright © 2011 Menzies et al; лицензиат BioMed Central Ltd. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе, при условии правильного цитирования оригинальной работы. Эта статья цитировалась в других статьях в PMC.
Дополнительные материалы

Дополнительный файл 1 Рисунок S1: Выравнивание предсказанной белковой последовательности для пролактина таммара .Предшественник ПРЛ был высококонсервативным у видов позвоночных, включая шесть остатков цистеина (обозначенных красными буквами) в положениях 33, 40, 87, 203, 220 и 228 относительно валлаби. Эти аминокислоты образуют три дисульфидные связи, способствующие трехмерной структуре зрелого белка. У млекопитающих есть 14 аминокислот (обозначенных звездочкой), которые необходимы для сайта связывания рецептора GH 1. Все эти аминокислоты законсервированы в таммаре. Кроме того, Ala51 и Gly158 (обозначены черными стрелками) необходимы для связывания в сайте 2, и они также консервативны у таммара и других позвоночных.

GUID: 9CBBAF1A-B91E-4ACB-B6A0-DCB09E9FA6B9

Дополнительный файл 2 Рисунок S2: Прогнозируемая последовательность белка для β-субъединицы лютеинизирующего гормона таммара . Белковые последовательности для обеих субъединиц (α и β) уже описаны для красного кенгуру [15]. Предсказанная последовательность таммара была идентична последовательности красного кенгуру, за исключением дополнительного лейцина в положении 14 относительно таммара.

GUID: C6DFA629-385E-4EE0-9A44-1A838D8A2A3C

Abstract

Предпосылки

Плацента необходима для снабжения питательными веществами и газами развивающегося детеныша млекопитающего до рождения.В то время как у всех млекопитающих есть функциональная плацента, только у терианских млекопитающих (сумчатых и эвтерианских) плацента плотно прилегает к эндометрию матки или вторгается в него. Плацента плаценты выделяет гормоны, которые структурно и функционально подобны гормону роста гипофиза (ГР), пролактину (ПРЛ) и лютеинизирующему гормону (ЛГ). Сумчатые и европейские млекопитающие произошли от общего предка примерно 125–148 миллионов лет назад и разработали различные репродуктивные стратегии. Как и у обычных животных, у сумчатых животных для эмбриогенеза необходима недолговечная, но функциональная плацента.

Результаты

Мы охарактеризовали гипофизарный GH, GH-R, IGF-2, PRL и LHβ у макроподидных сумчатых, таммар валлаби, Macropus eugenii . Эти гены экспрессируются в таммарной плаценте в течение последней трети гестации, когда происходит наибольший рост плода и начинается активный органогенез. МРНК ключевых генов роста GH, GH-R, IGF-2 и PRL экспрессировалась на поздних сроках беременности. Мы обнаружили значительную активацию GH, GH-R и IGF-2 после начала фазы быстрого роста органогенеза, что предполагает, что гормоны роста плаценты регулируют быструю фазу роста плода.

Выводы

Это первая демонстрация существования гормонов гипофиза в сумчатой ​​плаценте. Плацентарная экспрессия этих гормонов гипофиза явно сохранена у сумчатых, как и у белых млекопитающих, что указывает на наследственное происхождение эволюции плацентарной экспрессии и критическую функцию этих гормонов в росте и развитии всех терианских млекопитающих.

Предпосылки

Гормон роста (GH) является основным регулятором нормального постнатального роста у млекопитающих, а также важен для поддержания липидного, углеводного, азотного и минерального метаболизма [1].Ген GH мало изменился за время эволюции млекопитающих [2]. Однако у высших приматов и парнокопытных животных ген претерпел дупликации, за которыми последовали быстрые, независимые всплески эволюции, в результате чего последовательности этих видов сильно отличались от всех других [3]. У человека существуют четыре GH-подобных гена, включая три хорионических соматомаммотропина (A, B и L) и один вариант GH (GH-V или плацентарный GH), все из которых продуцируются исключительно плацентой [4].Эти гены обладают высокой степенью сходства последовательностей и структур, состоящих из пяти экзонов и четырех интронов, расположенных в тандеме на длинном плече хромосомы 17, и каждый кодирует зрелый белок примерно из 190–200 аминокислот [4]. Интересно, что экзон 3 рецептора GH (GH-R), который отвечает за внеклеточное связывание и передачу сигнала GH, отсутствует у сумчатых или монотремных животных [5]. Хотя это не влияет на постнатальный рост, последовательности экзона 3 млекопитающих с плацентарными вариантами GH и PRL гораздо более вариабельны, чем последовательности без вариантов плацентарного гормона.Недавно было показано, что человеческий GH-V играет важную роль в инвазии трофобластов в эндометрий, стимулируя его рецептор GH-R [6].

У овец существует два аллельных варианта гена гормона роста. Аллель GH-1 содержит одну копию гипофизарного GH, в то время как аллель GH-2 содержит две тандемные копии гена GH, обозначенные Gh3-N и Gh3-Z [7]. Gh3-N кодирует GH гипофиза, а Gh3-Z содержит три аминокислотные замены и экспрессируется только в плаценте овцы.Хотя аллель GH-2, по-видимому, чаще встречается в популяциях овец, чем у GH-1, животные, гомозиготные или гетерозиготные по любому из аллелей, по-прежнему продуцируют гипофизарный GH в плаценте, и нет различий в росте между плодами с разным аллельным составом [ 7]. В то время как коза имеет схожий состав генов GH, имея общего предка с овцами примерно 5 миллионов лет назад, есть также свидетельства наличия дубликатов генов GH у шевротена, благородного оленя, жирафа и бегемота [2].Однако неизвестно, гомологичны ли эти отдельные дупликации другим группам.

Эвтерианские млекопитающие, такие как грызуны и коровы, развили определенные варианты пролактина, которые экспрессируются в плаценте. Всего 21 такой ген существует у грызунов и 8 - у коровы [8]. Считается, что в пределах Rodentia многие из этих вариантов являются ортологами. Однако варианты коровы и грызунов не являются ортологами, демонстрируя независимое дублирование и дивергенцию этих последовательностей.

Плацентарная экспрессия вариантов гормонов гипофиза, включая GH, PRL и LH-β (из которых хорионический гонадотропин человека (ХГЧ) обеспечивает первый сигнал о наступающей беременности от человеческого концептуса), вероятно, происходит из-за тканеспецифической экспрессии концептусом или плацента, за которой следует дупликация гена исходного гена для определенной функции. Если это верно, то можно ожидать, что плаценты самых разных млекопитающих будут вырабатывать гипофизарную форму этих гормонов для общих функций во время беременности.Сумчатые животные представляют собой идеальную модель для изучения эволюции этих генов. У сумчатых есть полностью функциональная, но недолговечная плацента, которая вырабатывает по крайней мере некоторые гормоны [9]. Однако высокорослые детеныши, родившиеся после очень короткой беременности, завершают свое развитие в течение длительного периода лактации либо в сумке, либо в гнезде [10]. Последний раз у евтерианцев и сумчатых был общий предок 125–147 миллионов лет назад [11,12], поэтому можно определить, были ли экспрессия плаценты и дупликация генов общей чертой предкового млекопитающего или это было более недавним эволюционным событием, которое произошло только в евтерианская родословная.

Первая последовательность GH сумчатого гипофиза была выделена у опоссума щеточного хвоста, Trichosurus vulpecula [13], и имеет значительную идентичность последовательности с GH свиньи и лошади (виды, у которых GH высококонсервативны) с приблизительно 87% идентичностью белка. Это свидетельствует о сохранении скорости эволюции GH у сумчатых, аналогичной той, которая описана для большинства млекопитающих [2,13]. Последовательности пролактина опоссума и LH-β красного кенгуру также были выделены и имеют значительную идентичность белков с другими млекопитающими [14,15].

Последовательности GH гипофиза были клонированы из широкой группы млекопитающих. Однако сравнения с плацентарным GH, PRL и LH в основном изучались у коров, овец, крыс, мышей, людей и других приматов [8]. Таким образом, экспрессия этих важных гормонов, по-видимому, является общей особенностью здоровых людей и, как и у людей, может обеспечивать различные функции в метаболизме и распознавании беременности. Сумчатые до сих пор не исследованы, и почти ничего не известно о сохранении и экспрессии гормонов гипофиза у любого неэвтериального млекопитающего.Таким образом, в данном исследовании изучается состав последовательности и экспрессия гормонов гипофиза GH, PRL и LH-β в плаценте сумчатого tammar wallaby Macropus eugenii . Мы также количественно определили экспрессию в триламинарной плаценте в течение последней трети беременности, когда происходит активный органогенез.

Результаты

Выделение и экспрессия генов гипофиза в таммарной плаценте

Сначала мы выделили гипофизарную последовательность GH, чтобы установить, есть ли какие-либо вариации последовательности, указывающие на варианты плаценты.Гипофизарный GH был амплифицирован и секвенирован у взрослого таммара (n = 2; оба мужчины). Он имел значительную белковую идентичность с опоссумом (99%; таблица) и другими млекопитающими. Тот же набор праймеров (таблица) был использован для амплификации и секвенирования этого гена из плаценты на 23 день беременности (675 пар оснований; рисунок). Полученная последовательность охватывает множество интронов и всю открытую рамку считывания (ORF). Не было различий в последовательности между валлаби гипофизарным и плацентарным GH. Затем мы проанализировали ткань плаценты на рецептор GH.Полноразмерная кДНК GH-R была ранее клонирована из печени взрослых таммаров и их детенышей из кармана [5]. Не было изменений в последовательности мРНК GH-R в биламинарной (BYS) и триламинарной (TYS) плаценте по сравнению с таковой мРНК GH-R печени. С 18 по 25 день беременности наблюдалась сильная экспрессия GH и GH-R как в трех-, так и в биламинарной плаценте (189 пар оснований; рисунок).

Таблица 1

Значения выравнивания белков для генов таммара GH, PRL и LH- β по сравнению с другими сумчатыми и эвтериальными млекопитающими

908po92 Серый короткохвостый Monodelphis domestica 9070 Equus caballus8 9070 9089 2 83
Общее название Название вида Гомология GH
(%)
Гомология PRL (%)
гомология (%)
LH-β
гомология (%)
Brushtail опоссум Trichosurus vulpecula 99 97 97
96 93 94
Свинья Sus scrofa 85 85 80
Лошадь 73
Кролик Oryctolagus cuniculus 82 84
Человек Homo sapiens 65 a 85 66 a

Таблица 2

Гены, праймеры, температуры отжига (Tm) и количество циклы, используемые для амплификации конкретных генов

Entre -nucleotide "," attrs ": {" text ":" AM993150 "," term_id ":" 1846 "}} AM993150
Ген F-праймер R-праймер Tm Циклы ПЦР Идентификатор доступа
GH GGACGCTGGACC31 GGACGCTACCA90 C 30-35 {"type": "entrez-нуклеотид", "attrs": {"text": "EU918392", "term_id": "195764989"}} EU918392
GH-R CCCTGGCAAGTTCAAATGAT GGCATTCTTTCCACTCTTCG 60 ° C 30-35 {"type": "entrez-nucleotide", "attrs": {"text": "EU_472376", " }} EU682376
PRL ACCACCAACTCCTTCTGGTG GGAGCAAATTATAAAATGCA 58 ° C 30-35 {"type": "entrez-nucleotide", "attrs": {"term_24id": "FJ" 229424493 "}} FJ434245
LH-β AGATACCAGGAGCTCACAGT GAATTTGGGGGATGGAAAAG 58 ° C 30-35 " тип "," ядро ​​"," тип ":" ядро ​​"," тип ":" ядро ​​" ":" FJ434244 "," term_id ":" 229424491 "}} FJ434244
IGF-2 CCTTTGTGGTGGGGAACTGGT GGATGGGGTCTTCGCTG92 GGATGGGGTCTTCGCTG92 60892 9092

Количественное выражение GH, GH-R, IGF-2 и PRL в триламинарной плаценте желтокса .Относительная экспрессия мРНК генов роста GH, GH-R и IGF-2 значительно увеличилась по сравнению с β-актином после разрыва оболочки в таммарной плаценте. Этот период беременности характеризуется быстрым ростом и развитием плода до рождения альтрициального детеныша (n = от 3 до -6 на каждую стадию; буквы указывают на значимые различия) P <0,05; не было значительных изменений экспрессии пролактина (ПРЛ) в течение этот период; GH, гормон роста; GH-R, рецептор гормона роста; IGF-2, инсулиноподобный фактор роста-2) .

мРНК для PRL и LH-β также были впервые выделены из гипофиза для сравнения этих последовательностей с плацентарными изолятами. Обе эти последовательности обладали значительной белковой идентичностью с таковой у опоссума щеточного хвоста (97% каждая; таблица; дополнительный файл 1, рисунок S1) и других млекопитающих. Предполагаемый белок PRL имел много консервативных структурных особенностей, включая 6 остатков цистеина, которые образуют 3 дисульфидных мостика, которые важны для трехмерной структуры белка, а также 15 аминокислот, которые необходимы для связывания с рецептором [16].Точно так же предполагаемый гликопротеин LH-β содержал несколько консервативных элементов, включая остатки цистеина, необходимые для связывания с цепью LH-α (дополнительный файл 2, рисунок S2). Плацентарные мРНК PRL и LH-β экспрессировались с 18 по 25 день беременности как в трех-, так и в биламинарном желточном мешке плаценты (652 и 509 пар оснований, соответственно; рисунок; рисунок). Последовательности мРНК плаценты для PRL и LH-β охватывают большинство ORF этих генов, подобных GH, и охватывают несколько интронов.Плацентарные изоляты PRL и LH-β были идентичны изолятам гипофиза.

Экспрессия LH-β в плаценте таммарного валлаби . Экспрессия гена мРНК в ткани плаценты с 18 по 25 день беременности у таммарного валлаби. Выделение и экспрессия этого гена гипофиза в плаценте сумчатых животных предполагает, что ортологи этих генов могут быть обнаружены в плаценте всех млекопитающих. (BYS: биламинарный желточный мешок; La: ДНК-лестница; TYS: трехламинарный желточный мешок; -ve: отрицательный контроль).

Количественная экспрессия GH, GH-R и IGF-2

Экспрессия генов роста GH, GH-R и IGF-2 была низкой в ​​период разрыва оболочки (18 день; рисунок). После потери оболочки (рисунок), прикрепления и пересечения трофобласта с эпителием матки, экспрессия GH и IGF-2 значительно увеличилась, достигая пика на 24 и 21 день беременности, соответственно. Увеличение экспрессии GH-R после прикрепления не было значительным, хотя и выше, чем наблюдаемое в последние два дня беременности (рисунок).Экспрессия ПРЛ снижалась на всех проанализированных стадиях, но не было значительных различий в экспрессии с 18 по 25 день беременности (рисунок).

Рост и развитие таммарного эмбриона и плода . (a) На 18 день концептус выходит из разорванной оболочки оболочки (Sh), так что две области плаценты могут плотно прикрепляться к эпителию матки. Правая сторона эмбриона уже свободна от шерсти, в то время как сам эмбрион все еще находится внутри оболочки. (b) Эмбрион d18, свободный от плодных оболочек, четко различающий сосудистые и несосудистые области желточного мешка (BYS: биламинарный желточный мешок; TYS триламинарный желточный мешок; ST sinus terminalis). (c) Плод на 23 день беременности, демонстрирующий увеличение сосудистой области и плотное прикрепление плаценты к эпителию матки (Ut). Желточные сосуды видны. (d) Доношенный плод на 25 день беременности, примерно за день до родов.Аллантоис (All) большой, но удерживается в складках желточного мешка, который стал сильно сосудистым. У плода хорошо развиты передние конечности, готовые к подъему к сумке, а язык обычно высовывается (Am: amniopore).

Обсуждение

Таммарная плацента продуцирует гормоны гипофиза GH (и его рецептор), PRL и LH-β . До недавнего времени считалось, что сумчатые плаценты производят лишь ограниченное количество гормонов, но их присутствие, по крайней мере, в таммаре, предполагает, что эти эндокринные факторы могут быть присущи нормальной беременности и подготовке к лактации у всех млекопитающих.Эти результаты также расширяют предыдущие данные, указывающие на важную роль IGF2 в сумчатой ​​плаценте.

В настоящее время имеются убедительные доказательства того, что у обоих подклассов терианских млекопитающих (эвтерианских и сумчатых) фетоплацентарная единица оказывает локальное и системное воздействие на репродуктивный тракт, что приводит к распознаванию беременности матерью [17-20] . У макроподидных сумчатых эти ответы включают увеличение размера и секреторной активности беременных по сравнению с негравидным эндометрием, как прямой результат присутствия развивающегося эмбриона [20-23].Было высказано предположение, что эффект на плод может быть вызван либо эндокринным фактором, либо воспалительным действием [17,20]. Этим эмбриональным сигналом может быть LH-β или, точнее, хорионический гонадотропин, как специфический для плаценты продукт, обозначаемый у человеческих млекопитающих. Предварительные доказательства наличия биотестируемого хорионического гонадотропина были получены с помощью биоанализа (MB Renfree и L. Wide, неопубликованные результаты), но это больше никогда не исследовалось.

Настоящее исследование подтверждает, что LH-β синтезируется плацентой, и предполагает, что он, вместе с GH и PRL, может быть ответственным за наблюдаемую стимуляцию эндометрия матки для поддержания беременности.Также установлено, что эти гормоны гипофиза могут быть общим наследственным признаком плаценты терианских млекопитающих (рисунок).

Происхождение экспрессии гормона гипофиза в плаценте млекопитающих . Экспрессия гормонов гипофиза GH, GH-R, PRL и LH-β в желточном мешке плаценты таммарного валлаби предполагает, что эти гормоны могли обеспечивать общую функцию в плаценте общего предка терианских млекопитающих (синяя точка) . Исходя из этого обобщенного выражения, плаценты некоторых млекопитающих, включая человека, развили определенные копии генов, включая HCG, GH-V (красные точки; NV указывает на отсутствие вариантов последовательности у этих видов; GH, гормон роста; GH-R, рецептор гормона роста; GH-V, вариант гормона роста; HCG, хорионический гонадотропин человека; LH-β, субъединица-β лютеинизирующего гормона; PRL, пролактин; NV, без вариантов).

Рецепторы

PRL и LH присутствуют в яичнике опоссума хвостика [24], а рецепторы PRL находятся под строгим регулированием во время беременности в желтом теле таммарного валлаби и молочной железе [25]. Однако примерно за восемь часов до родов в таммаре присутствует пульс пролактина, который необходим для установления лактации [26,27], но он не может быть связан с плацентой, потому что мРНК плацентарного ПРЛ находится на самом низком уровне до рождения. Плацентарный ПРЛ может стимулировать эндометрий для поддержки эмбриона и плода у домашних животных, таких как овцы [28].Однако, учитывая низкий уровень экспрессии таммарной плаценты, отсутствие значительных количественных изменений во время прикрепления и низкий уровень экспрессии рецептора ПРЛ в эндометрии по сравнению с желтым телом (личное сообщение Х. Кларка), он вряд ли будет выполнять аналогичную функцию. в таммаре.

На сегодняшний день обнаружено лишь несколько эндокринных сигналов от сумчатой ​​плаценты, включая простагландин F2α, релаксин, инсулин и IGF-2 [29–32], а также начальную продукцию стероидов [33–35].Выделение GH , GH-R, PRL и LH-β из плаценты сумчатого животного показывает, что это гораздо более сложный орган, чем предполагалось изначально. Ткани плаценты в этом исследовании изучали в период с 18 по 26 день беременности, в период между первым прикреплением плаценты желточного мешка (18 день беременности) и доношенными сроками (роды: с 26 по 27 день), когда эта ткань, вероятно, быть наиболее метаболически активным. До этого периода (то есть от стадии бластоцисты до поздней стадии пузырьков) нет никаких доказательств того, что эмбрион подает сигнал матке, поскольку он окружен оболочкой, производимой эпителиальными клетками яйцевода и матки, и обе матки реагируют на увеличение циркулирующего прогестерона для стимуляции секреторного эпителия матки [20,21,36,37].Как только оболочка оболочки разрывается, эмбрион тесно переплетается с эпителием матки и кровоснабжением матери. Плод развивается быстро, и органогенез завершается ко времени рождения только через девять дней [10,38]. IGF-2 и GH - хорошие кандидаты для ускорения этого быстрого роста.

IGF-2 импринтируется по материнской линии в таммарной плаценте, как и все другие исследованные до сих пор виды эвтериальных животных [39]. Наличие геномного импринтинга предполагает, что IGF-2 играет доминирующую роль в секвестрации материнских ресурсов для плода.Однако повышение регуляции других важных генов роста, таких как GH и его рецептор, предполагает, что сумчатая плацента - это не просто инертная ткань, способная передавать маточные выделения плоду, но, как и у человеческих млекопитающих, она должна активно расти и выделять критически важные ткани. гормоны, чтобы он мог питать непрерывный рост концептуса.

Выводы

Открытие соматотропинов и гонадотропинов в желточном мешке плаценты таммарского валлаби поддерживает растущие знания о функции сумчатой ​​плаценты и демонстрирует, что сумчатая плацента является полностью функциональным и сложным органом физиологического обмена между матерью и плодом.Это также предполагает наследственную роль этих гормонов в воспроизводстве всех млекопитающих.

Методы

Животные

Валлаби Таммар, происходящие с острова Кенгуру, содержались в нашей колонии в больших, покрытых травой вольерах. Их травяная диета была дополнена кубиками люцерны и овощами, а питьевая вода была обеспечена ad libitum . Все эксперименты были одобрены институциональными комитетами по этике животных Мельбурнского университета и соответствовали рекомендациям Австралийского национального совета по здравоохранению и медицинским исследованиям (2004 г.).

Сбор тканей

Целые плаценты были взяты условно от плодов, собранных для других экспериментов. Как биламинарные, так и триламинарные области плаценты осторожно отделяли от плода и эндометрия и помещали в криопробирки без РНК, быстро замораживали в жидком азоте и хранили при -80 ° C.

Экстракция РНК и клонирование гена

Общая РНК была экстрагирована из 50–200 мг плацентарной ткани с использованием RNAwiz (Ambion, Остин, США) {AU Query: Please add city in Texas and USA} согласно протоколу производителя.Качество РНК оценивали электрофорезом на геле бромистого этидия и детектированием чистых 18 и 24 S полос. Неповрежденные образцы обрабатывали ДНКазой с использованием набора без ДНК (Ambion, Остин, США) {запрос AU: сюда также следует указать город и США} и хранили в защищенной от РНК воде при -80 ° C. Концентрации РНК определяли с помощью спектрофотометра NanoDrop (Thermo Scientific, Уилмингтон, США) {Запрос Австралии: укажите город, штат и страну для Thermo Scientific}, после чего точно 1 мкг общей РНК обрабатывали с использованием системы синтеза первой цепи Superscript III для ОТ-ПЦР (Invitrogen, Карлсбад, США) {AU Q} uery: Пожалуйста, добавьте город и штат для Intitrogen} для получения комплементарной ДНК (кДНК).Полноразмерные последовательности были получены с помощью ПЦР с обратной транскриптазой с использованием кДНК плаценты, GoTaq (Promega, Мэдисон, США) {Запрос Австралии: укажите город, штат и страну для мастер-микса Promega} и праймеров из консервативных областей последовательностей хвостатых опоссумов ( GH : {"type": "entrez-нуклеотид", "attrs": {"text": "AF052192", "term_id": "3002998"}} AF052192; PRL : {"type": "entrez -nucleotide "," attrs ": {" text ":" AF054634 "," term_id ":" 3025757 "}} AF054634; LH-β : {" type ":" entrez-нуклеотид "," attrs ": { "text": "AF017448", "term_id": "2738806"}} AF017448; GH-R : {"type": "entrez-нуклеотид", "attrs": {"text": "AF467545", " term_id ":" 18542392 "}} AF467545).Затем специфичность этих транскриптов была подтверждена гомологией BLAST и идентификацией в архивах следов таммарного валлаби в NCBI (инвентарный номер GenBank: GH : {"type": "entrez-нуклеотид", "attrs": {"text": "EU918392", "term_id": "195764989"}} EU918392; GH-R : {"type": "entrez-нуклеотид", "attrs": {"text": "EU682376", "term_id": " 194719512 "}} EU682376; LH-β: {" type ":" entrez-нуклеотид "," attrs ": {" text ":" FJ434244 "," term_id ":" 229424491 "}} FJ434244; PRL : {"type": "entrez-нуклеотид", "attrs": {"text": "FJ434245", "term_id": "229424493"}} FJ434245).{AY Query: необходимо добавить регистрационные номера GenBank} Затем были сконструированы праймеры для конкретных видов из полноразмерной последовательности GH для использования в анализе qPCR. Праймеры QPCR для IGF-2 были воспроизведены у Ager et al (2008) [31]. Праймеры были сконструированы так, чтобы охватить интроны, так что обнаруживалась только кДНК, что подтверждено гель-электрофорезом. QPCR выполняли с использованием набора Quantitec Sybr Green PCR Kit (Qiagen, Germantown, США) {AU Query: Please add the city, state, and country for Qiagen}, и реакции выполнялись в трех экземплярах на мониторе Opticon 2 (MJ Research, Waltham USA) { AU Query: Пожалуйста, добавьте город, штат и страну для MJ Research}.Количество транскриптов из интересующих генов сравнивали с геном домашнего хозяйства β-актина Fwd, TTGCTGACAGGATGCAGAAG, Rev, AAAGCCATGCCAATCTCATC путем сравнения порогов амплификации с помощью программного обеспечения Opticon 2 Monitor. Все праймеры были приобретены у Sigma-Aldrich, и продукты количественной ПЦР подтверждены BLAST с использованием наименее строгих параметров в NCBI. Секвенирование транскриптов проводили в Центре секвенирования благотворительного фонда Gandel Charitable Trust (Университет Монаша). Последовательности праймеров, температуры отжига и длительность цикла ПЦР можно найти в таблице.

Белковые последовательности LHβ и PRL представлены в дополнительном файле 1 на рисунке S1 и в дополнительном файле 2 на рисунке S2. Последовательности GH [40], GH-R [5] и IGF2 [38] были ранее опубликованы.

Статистика

Анализ экспрессии гормонов гипофиза GH, GH-R и LH-β с помощью стандартной ПЦР был повторен в образцах BYS и TYS от трех разных индивидуумов на 18, 21, 23, 24 и 25 дни беременности. Количественный анализ был проведен на образцах TYS (от четырех до шести на этап) также на 18, 21, 23, 24 и 25 дни беременности.Анализ дисперсии и множественные сравнительные тесты были выполнены с использованием Systat Version 13, и статистически значимые результаты были представлены как P <0,05. Данные представлены в виде средних значений ± среднеквадратичное отклонение.

Список сокращений

BYS: биламинарный желточный мешок; GH: гормон роста; GH-R: рецептор гормона роста; IGF-2: инсулиноподобный фактор роста-2; LH-β: субъединица-β лютеинизирующего гормона; ПРЛ: пролактин; TYS: трехламинарный желточный мешок.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересов.

Вклад авторов

MBR и BRM задумали эксперименты. MBR собрал и препарировал ткани. BRM выполнила молекулярный анализ. AJP помогала с анализами. Все авторы внесли свой вклад в интеллектуальный дизайн экспериментов и написание рукописи. Все авторы прочитали и одобрили окончательную рукопись.

Дополнительный материал

Дополнительный файл 1:

Рисунок S1: Выравнивание предсказанной белковой последовательности для пролактина таммара .Предшественник ПРЛ был высококонсервативным у видов позвоночных, включая шесть остатков цистеина (обозначенных красными буквами) в положениях 33, 40, 87, 203, 220 и 228 относительно валлаби. Эти аминокислоты образуют три дисульфидные связи, способствующие трехмерной структуре зрелого белка. У млекопитающих есть 14 аминокислот (обозначенных звездочкой), которые необходимы для сайта связывания рецептора GH 1. Все эти аминокислоты законсервированы в таммаре. Кроме того, Ala51 и Gly158 (обозначены черными стрелками) необходимы для связывания в сайте 2, и они также консервативны у таммара и других позвоночных.

Дополнительный файл 2:

Рисунок S2: Прогнозируемая белковая последовательность для β-субъединицы лютеинизирующего гормона таммара. Белковые последовательности для обеих субъединиц (α и β) уже описаны для красного кенгуру [15]. Предсказанная последовательность таммара была идентична последовательности красного кенгуру, за исключением дополнительного лейцина в положении 14 относительно таммара.

Благодарности

Мы благодарим Хелен Кларк за техническую поддержку этого проекта. Это исследование было поддержано Центром передового опыта в области геномики кенгуру Австралийского исследовательского совета (ARC), стипендией Федерации ARC для MBR и стипендией RD Wright Национального совета по здравоохранению и медицинским исследованиям для AJP.

Ссылки

  • Frago LM, Chowen JA. В: Основы физиологии оси гормона роста / инсулиноподобного фактора роста. В оси гормона роста / инсулиноподобного фактора роста во время развития. Варела-Ньето И., Чоуэн Дж. А., редактор. Нью-Йорк: Спрингер; 2005. С. 1–15. [Google Scholar]
  • Форсайт И.А., Уоллис М. Гормон роста и пролактин - молекулярная и функциональная эволюция. J Mammary Gland Biol Neoplasia. 2002; 7: 291–312. DOI: 10,1023 / А: 1022804817104. [PubMed] [CrossRef] [Google Scholar]
  • Wallis M.Молекулярная эволюция гормонов роста позвоночных: модель, близкая к стазису, прерываемая устойчивыми всплесками быстрых изменений. J Mol Evol. 1996; 43: 93–100. DOI: 10.1007 / BF02337353. [PubMed] [CrossRef] [Google Scholar]
  • Бауманн Г. Гетерогенность гормона роста: гены, изогормоны, варианты и связывающие белки. Endocr Rev.1991; 12: 424–449. DOI: 10.1210 / edrv-12-4-424. [PubMed] [CrossRef] [Google Scholar]
  • Мензис Б. Р., Шоу Г., Флетчер Т. П., Ренфри МБ. Экзон 3 рецептора гормона роста (GH-R) специфичен для здоровых млекопитающих.Mol Cell Endocrinol. 2008. 296: 64–68. DOI: 10.1016 / j.mce.2008.07.010. [PubMed] [CrossRef] [Google Scholar]
  • Lacroix MC, Guibourdenche J, Fournier T, Laurendeau I, Igout A, Goffin V, Pantel J, Tsatsaris V, Evain-Brion D. Стимуляция вторжения в трофобласт человека плацентарным гормоном роста . Эндокринология. 2005; 146: 2434–2444. DOI: 10.1210 / en.2004-1550. [PubMed] [CrossRef] [Google Scholar]
  • Уоллис М., Лиупис А., Уоллис О.К. Дубликаты генов гормона роста у овец и коз. J Mol Endocrinol.1998; 21: 1–5. DOI: 10.1677 / jme.0.0210001. [PubMed] [CrossRef] [Google Scholar]
  • Соарес MJ. Семейства пролактина и гормона роста: специфические для беременности гормоны / цитокины на границе раздела матери и плода. Репрод Биол Эндокринол. 2004; 2: 51. DOI: 10.1186 / 1477-7827-2-51. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Renfree MB. Сумчатые: плацентарные млекопитающие с отличием. Плацента. 2010; 31: S21–26. [PubMed] [Google Scholar]
  • Tyndale-Biscoe CH, Renfree MB.Репродуктивная физиология сумчатых. Кембридж: Издательство Кембриджского университета; 1987. [Google Scholar]
  • Бининда-Эмондс О.Р., Кардилло М., Джонс К.Э., Макфи Р.Д., Бек Р.М., Греньер Р., Прайс С.А., Вос Р.А., Гиттлман Дж. Л., Первис А. Отсроченный рост современных млекопитающих. Природа. 2007; 446: 507–512. DOI: 10,1038 / природа05634. [PubMed] [CrossRef] [Google Scholar]
  • Ло ZX, Джи Q, Wible JR, Юань CX. Раннемеловое трибосфеновое млекопитающее и эволюция метатерии. Наука. 2003; 302: 1934–1940.DOI: 10.1126 / science.10. [PubMed] [CrossRef] [Google Scholar]
  • Saunders MC, Deakin J, Harrison GA, Curlewis JD. Клонирование кДНК гормона роста из опоссума щеточного хвоста ( Trichosurus vulpecula, ) Gen Comp Endocrinol. 1998. 111: 68–75. DOI: 10.1006 / gcen.1998.7090. [PubMed] [CrossRef] [Google Scholar]
  • Керлевис Дж. Д., Сондерс М. С., Куанг Дж., Харрисон Г. А., Купер Д. В.. Клонирование и анализ последовательности кДНК пролактина гипофиза из опоссума щеточного хвоста ( Trichosurus vulpecula, ) Gen Comp Endocrinol.1998. 111: 61–67. DOI: 10.1006 / gcen.1998.7089. [PubMed] [CrossRef] [Google Scholar]
  • Харрисон Г.А., Дин Е.М., Купер Д.В. Клонирование кДНК субъединиц лютеинизирующего гормона из щетинистого опоссума и красного кенгуру. Мамм Геном. 1998. 9: 638–642. DOI: 10.1007 / s003359

    6. [PubMed] [CrossRef] [Google Scholar]
  • Гоффин В., Шиверик К.Т., Келли П.А., Марсьяль Д.А. Связь «последовательность-функция» в расширяющемся семействе пролактина, гормона роста, плацентарного лактогена и родственных белков у млекопитающих.Endocr Rev.1996; 17: 385–410. [PubMed] [Google Scholar]
  • Renfree MB. Распознавание беременности у сумчатых животных. Rev Reprod. 2000; 5: 6–11. DOI: 10.1530 / ror.0.0050006. [PubMed] [CrossRef] [Google Scholar]
  • Смит Р., Мезиано С., МакГрат С. Траектории гормонов, ведущие к человеческому рождению. Regul Pept. 2002; 108: 159–64. DOI: 10.1016 / S0167-0115 (02) 00105-2. [PubMed] [CrossRef] [Google Scholar]
  • Short RV. В: Симпозиум Фонда CIBA по автономии плода. Wolstenholme GEW, О'Коннор М., редактор.Лондон: Черчилль; 1969. От имплантации и признания беременности матерью; С. 2–26. [Google Scholar]
  • Renfree MB. Влияние эмбриона на сумчатую матку. Природа. 1972; 240: 475–477. DOI: 10.1038 / 240475a0. [PubMed] [CrossRef] [Google Scholar]
  • Renfree MB, Tyndale-Biscoe CH. Внутриутробное развитие после диапаузы у сумчатых Macropus eugenii. Dev Biol. 1973; 32: 28-40. DOI: 10.1016 / 0012-1606 (73)

    -0. [PubMed] [CrossRef] [Google Scholar]
  • Tyndale-Biscoe CH.В кн .: Признание беременности матерью. редактор симпозиума Фонда CIBA, редактор. Амстердам: Симпозиум Фонда CIBA, Exerpta Medica; 1979. Гормональный контроль эмбриональной диапаузы и реактивации таммарного валлаби; С. 172–190. [Google Scholar]
  • Renfree MB, Tyndale-Biscoe CH. Внутриутробное развитие после диапаузы у сумчатых животных, Macropus eugenii . Dev Biol. 1973; 32: 28-40. DOI: 10.1016 / 0012-1606 (73)

    -0. [PubMed] [CrossRef] [Google Scholar]
  • Эккери, округ Колумбия, Лун С., Томсон Б.П., Чи В.Н., Мур Л.Г., Джуэнгель Дж.Л.Экспрессия в яичниках матричной РНК, кодирующей рецепторы лютеинизирующего гормона и фолликулостимулирующего гормона, у сумчатых, опоссума щеточного хвоста ( Trichosurus vulpecula, ) Biol Reprod. 2002; 66: 1310–1317. DOI: 10.1095 / biolreprod66.5.1310. [PubMed] [CrossRef] [Google Scholar]
  • Sernia C, Tyndale-Biscoe CH. Рецепторы пролактина в молочной железе, желтом теле и других тканях таммарного валлаби, Macropus eugenii . J Endocrinol. 1979; 83: 79–89. DOI: 10.1677 / joe.0.0830079. [PubMed] [CrossRef] [Google Scholar]
  • Хайндс, Лос-Анджелес, Тиндейл-Бискоу, Швейцария. Пролактин у сумчатых Macropus eugenii, во время эстрального цикла, беременности и кормления грудью. Биол Репрод. 1982; 26: 391–398. DOI: 10.1095 / biolreprod26.3.391. [PubMed] [CrossRef] [Google Scholar]
  • Флетчер Т.П., Шоу Г., Ренфри МБ. Эффекты бромокриптина при родах таммарного валлаби, Macropus eugenii. Reprod Fertil Dev. 1990; 2: 79–88. DOI: 10.1071 / RD9

    9. [PubMed] [CrossRef] [Google Scholar]
  • Спенсер Т.Э., Базер Ф.В.Маточные и плацентарные факторы, регулирующие рост концептуальных клеток домашних животных. J Anim Sci. 2004; 82 (E-Suppl): E4–13. [PubMed] [Google Scholar]
  • Парри Л.Дж., Ренфри МБ. Начало экспрессии гена релаксина в плаценте таммарного валлаби. Biol Reprod Suppl. 1999; 60: 25. [Google Scholar]
  • Shaw G, Gehring HM, Bell EC. Продукция простагландина F2alpha и его метаболита эндометрием и желточным мешком плаценты на поздних сроках беременности таммарного валлаби, Macropus eugenii . Биол Репрод.1999. 60: 611–614. DOI: 10.1095 / biolreprod60.3.611. [PubMed] [CrossRef] [Google Scholar]
  • Эджер Э., Паск А.Дж., Ренфри МБ. Экспрессия и локализация белка IGF2 в сумчатой ​​плаценте. BMC Dev Biol. 2008; 8: 17. DOI: 10.1186 / 1471-213X-8-17. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Агер Э, Сузуки С., Паск Дж., Шоу Г., Ишино Ф., Renfree MB. Инсулин отпечатывается в плаценте сумчатого животного, Macropus eugenii . Dev Biol. 2007. 309: 317–328. DOI: 10.1016 / j.ydbio.2007.07.025. [PubMed] [CrossRef] [Google Scholar]
  • Renfree MB, Heap RB. Метаболизм стероидов плацентой, желтым телом и эндометрием сумчатых животных Macropus eugenii . Териогенология. 1977; 8: 164. DOI: 10.1016 / 0093-691X (77)

    -1. [CrossRef] [Google Scholar]

  • Heap RB, Renfree MB, Burton RD. Метаболизм стероидов в желточном мешке, плаценте и эндометрии таммарного валлаби, Macropus eugenii . J Endocr. 1980; 87: 339–349. DOI: 10,1677 / Джо.0,0870339. [PubMed] [CrossRef] [Google Scholar]
  • Renfree MB. В: Эндокринология 1980. Камминг И.А., Фундер Дж. У., Мендельсон ФАО, редактор. Канберра: Австралийская академия наук; 1980. Эндокринная активность при сумчатой ​​плацентации; С. 83–86. [Google Scholar]
  • Renfree MB. Белки в секрете матки сумчатых животных, Macropus eugenii . Dev Biol. 1973; 32: 41–49. DOI: 10.1016 / 0012-1606 (73)

    -2. [PubMed] [CrossRef] [Google Scholar]

  • Tyndale-Biscoe CH, Hearn JP, Renfree MB.Контроль размножения макроподидных сумчатых. J Endocr. 1974. 63: 589–614. DOI: 10.1677 / joe.0.0630589. [PubMed] [CrossRef] [Google Scholar]
  • Renfree MB. Состав плодных жидкостей сумчатого животного, Macropus eugenii .

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *