Вирус корсака: Вирус Коксаки. Что это?

Содержание

Россия напала на Украину!

Россия напала на Украину!

Мы, украинцы, надеемся, что вы уже знаете об этом. Ради ваших детей и какой-либо надежды на свет в конце этого ада –  пожалуйста, дочитайте наше письмо .

Всем нам, украинцам, россиянам и всему миру правительство России врало последние два месяца. Нам говорили, что войска на границе “проходят учения”, что “Россия никого не собирается захватывать”, “их уже отводят”, а мирное население Украины “просто смотрит пропаганду”. Мы очень хотели верить вам.

Но в ночь на 24-ое февраля Россия напала на Украину, и все самые худшие предсказания  стали нашей реальностью .

Киев, ул. Кошица 7а. 25.02.2022

 Это не 1941, это сегодня. Это сейчас. 
Больше 5 000 русских солдат убито в не своей и никому не нужной войне
Более 300 мирных украинских жителей погибли
Более 2 000 мирных людей ранено

Под Киевом горит нефтебаза – утро 27 февраля, 2022.

Нам искренне больно от ваших постов в соцсетях о том, что это “все сняли заранее” и “нарисовали”, но мы, к сожалению, вас понимаем.

Неделю назад никто из нас не поверил бы, что такое может произойти в 2022.

Метро Киева, Украина — с 25 февраля по сей день

Мы вряд ли найдем хоть одного человека на Земле, которому станет от нее лучше. Три тысячи ваших солдат, чьих-то детей, уже погибли за эти три дня. Мы не хотим этих смертей, но не можем не оборонять свою страну.

И мы все еще хотим верить, что вам так же жутко от этого безумия, которое остановило всю нашу жизнь.

Нам очень нужен ваш голос и смелость, потому что сейчас эту войну можете остановить только вы. Это страшно, но единственное, что будет иметь значение после – кто остался человеком.

ул.

Лобановского 6а, Киев, Украина. 26.02.2022

Это дом в центре Киева, а не фото 11-го сентября. Еще неделю назад здесь была кофейня, отделение почты и курсы английского, и люди в этом доме жили свою обычную жизнь, как живете ее вы.

P.S. К сожалению, это не “фотошоп от Пентагона”, как вам говорят. И да, в этих квартирах находились люди.

«Это не война, а только спец. операция.»

Это война.

Война – это вооруженный конфликт, цель которого – навязать свою волю: свергнуть правительство, заставить никогда не вступить в НАТО, отобрать часть территории, и другие. Обо всем этом открыто заявляет Владимир Путин в каждом своем обращении.

«Россия хочет только защитить ЛНР и ДНР.»

Это не так.

Все это время идет обстрел городов во всех областях Украины, вторые сутки украинские военные борются за Киев.

На карте Украины вы легко увидите, что Львов, Ивано-Франковск или Луцк – это больше 1,000 км от ЛНР и ДНР.
Это другой конец страны. 25 февраля, 2022 – места попадания ракет

25 февраля, 2022 – места попадания ракет «Мирных жителей это не коснется.»

Уже коснулось.

Касается каждого из нас, каждую секунду. С ночи четверга никто из украинцев не может спать, потому что вокруг сирены и взрывы. Тысячи семей должны были бросить свои родные города.
Снаряды попадают в наши жилые дома.

Больше 1,200 мирных людей ранены или погибли. Среди них много детей.
Под обстрелы уже попадали в детские садики и больницы.
Мы вынуждены ночевать на станциях метро, боясь обвалов наших домов.
Наши жены рожают здесь детей. Наши питомцы пугаются взрывов.

«У российских войск нет потерь.»

Ваши соотечественники гибнут тысячами.

Нет более мотивированной армии чем та, что сражается за свою землю.
Мы на своей земле, и мы даем жесткий отпор каждому, кто приходит к нам с оружием.

«В Украине – геноцид русскоязычного народа, а Россия его спасает.»

Большинство из тех, кто сейчас пишет вам это письмо, всю жизнь говорят на русском, живя в Украине.

Говорят в семье, с друзьями и на работе. Нас никогда и никак не притесняли.

Единственное, из-за чего мы хотим перестать говорить на русском сейчас – это то, что на русском лжецы в вашем правительстве приказали разрушить и захватить нашу любимую страну.

«Украина во власти нацистов и их нужно уничтожить.»

Сейчас у власти президент, за которого проголосовало три четверти населения Украины на свободных выборах в 2019 году.

Как у любой власти, у нас есть оппозиция. Но мы не избавляемся от неугодных, убивая их или пришивая им уголовные дела.

У нас нет места диктатуре, и мы показали это всему миру в 2013 году. Мы не боимся говорить вслух, и нам точно не нужна ваша помощь в этом вопросе.

Украинские семьи потеряли больше 1,377,000 родных, борясь с нацизмом во время Второй мировой. Мы никогда не выберем нацизм, фашизм или национализм, как наш путь. И нам не верится, что вы сами можете всерьез так думать.

«Украинцы это заслужили.»

Мы у себя дома, на своей земле.

Украина никогда за всю историю не нападала на Россию и не хотела вам зла. Ваши войска напали на наши мирные города. Если вы действительно считаете, что для этого есть оправдание – нам жаль.

Мы не хотим ни минуты этой войны и ни одной бессмысленной смерти. Но мы не отдадим вам наш дом и не простим молчания, с которым вы смотрите на этот ночной кошмар.

Искренне ваш, Народ Украины

МЕТОДИКА ОЦЕНКИ ПОСЛЕДСТВИЙ КИБЕРАТАК НА ПРОИЗВОДСТВЕННЫЙ ПРОЦЕСС | Корсаков

МЕТОДИКА ОЦЕНКИ ПОСЛЕДСТВИЙ КИБЕРАТАК НА ПРОИЗВОДСТВЕННЫЙ ПРОЦЕСС

Аннотация

Стремительное развитие современных информационных технологий управления приводит к появлению новых аспектов обеспечения их безопасности. В частности, особую актуальность приобрела проблема так называемой промышленной кибербезопасности, постепенно выделяемая в самостоятельную сферу научно-технических исследований. За последние годы количество атак на объекты промышленного производства значительно выросло. Об этом свидетельствуют данные отчетов ICS-CERT за 2014-2015 гг.

С вопросами кибербезопасности связаны несколько инцидентов, получивших широкое освещение в прессе. Например, вирус STUXNET, поражающий промышленные системы Siemens. STUXNET нанес серьезный урон иранской ядерной программе, используя уязвимости операционной системы и «человеческий фактор». На основе STUXNET был разработан целый ряд модифицированных вирусов, способных осуществлять успешные атаки на различные промышленные сети. Siemens является одним из ключевых производителей промышленного оборудования в мире, поэтому STUXNET ожидаемо получил широкое распространение и в 2013 году был даже обнаружен на российской АЭС. Таким образом, безопасность систем автоматизированного контроля управления технологическим процессом является критической в настойщее время и ее важность нельзя недооценивать.

 


Ключевые слова

промышленные сети; программируемые логические контроллеры; ПЛК; идентификация; сетевая безопасность; STUXNET; АСУ ТП


Литература

1. Nicolas Falliere, Liam O Murchu, and Eric Chien (Symantec), W32.Stuxnet Dossier, Ver 1.4 (February 2011)

2. The Real Story of Stuxnet. [Электронный ресурс] URL: http://spectrum.ieee.org/telecom/security/the-real-story-of-stuxnet (Дата обращения 06.10.2016).
3. ICS Security Workspace. Security Analysis from Siemens S7 PLC CPU Buffer [Chinese]
4. Aleksandr Matrosov, Eugene Rodionov, David Harley, Juraj Malcho (ESET), Stuxnet Under the Microscope, Revision 1.1 (September 2010)
5. Freydman A.V. Stuxnet i promyshlennaya bezopasnost, (Stuxnet and industrial safety), Avtomatizatsiya v promyshlennosti, 2011, No 11, pp. 48-53.
6. Stuxnet infected Russian nuclear plant. [Электронный ресурс] URL: http://www.itnews. com.au/news/stuxnet-infected-russian-nuclear-plant-363578 (Дата обращения 06.12.2016).
7. Peachey, C. Is stuxnet a threat to NPPs? (2010) Nuclear Engineering International, 55 (676), pp. 22-23.
8. NCCIC/ICS-CERT. Year in Review National Cybersecurity and Communications Integration Center/Industrial Control Systems Cyber Emergency Response Team. FY 2015
9. Cristea, M., Groza, B., Iacob, M. Some security issues in Scalance wireless industrial networks (2011) Proceedings of the 2011 6th International Conference on Availability, Reliability and Security, ARES 2011, art. no. 6046006, pp. 493-498.
10. Lau, S., Klick, J., Arndt, S., Roth, V. POSTER: Towards highly interactive honeypots for industrial control systems. (2016) Proceedings of the ACM Conference on Computer and Communications Security, 24-28-October-2016, pp. 1823-1825.
11. Powering-Up the Industrial Network. [Электронный ресурс] URL: http://www.panduit.com/ccurl/34/366/powering-up-ind-network,0. pdf (Дата обращения 06.12.2016).
12. What properties, advantages and special features does the S7 protocol offer? [Электронный ресурс] URL: https://support.industry.siemens.com/cs/document/26483647/what-properties-advantages-and-special-features-does-the-s7-protocol-offer-?dti=0&lc=en-WW (Дата обращения 06.12.2016).
13. SIMATIC WinCC / SIMATIC PCS 7: Information about Malware / Viruses / Trojan horses [Электронный ресурс] URL: https://support.industry.siemens.com/cs/document/43876783/simatic-wincc-simatic-pcs-7%3A-information-about-malware-viruses-trojan-horses?dti=0&lc=en-WW (Дата обращения 06.12.2016).
14. Chan, R., Chow, K.-P. Forensic analysis of a Siemens programmable logic controller. (2016) IFIP Advances in Information and Communication Technology, 485, pp. 117-130.


Об эпизоотической обстановке по бешенству на территории Томской области и России / Россельхознадзор

На основании анализа данных ФГБУ «ЦНМВЛ», поступивших из информационной системы «Сирано», с 16 по 31 декабря 2017 года в России зафиксировано 180 случаев бешенства.

Наибольшее количество случаев выявлено в Республике Бурятия, Воронежской, Саратовской, Белгородской и Липецкой областях. В большинстве своем бешенство отмечается: у лис — 56 случаев, у собак — 46 случаев, у кошек — 34 случая, у крупного рогатого скота — 22 случая, у енотовидных собак — 16 случаев.

Север Томской области является коридором миграции лис между Новосибирской областью, где в трех районах объявлен карантин по бешенству (Кочковский, Убинский и Купинский) и Красноярским краем (Берёзовский район). 25 января 2018 года ветнадзор Берёзовского района направил рекомендации в Правительство края губернатору с просьбой о наложении карантина в угрожаемой зоне, где случаи вспышек заболевания бешенством лис носят очагово-природный характер.

Обращаем внимание охотников-любителей и охотников-промысловиков при отстреле лисиц и корсаков обратить внимание на поведение животных. При подозрении на заболевание сообщить ветеринарной службе или сотруднику Россельхознадзора, обслуживающему данную территорию, для отбора проб и отправки для лабораторного заключения.

Жителям необходимо ограничить контакты с дикими животными, не охотиться в тех районах, где зафиксирован вирус. Их ни в коем случае нельзя кормить и гладить. Также ограничить контакты домашних животных с дикими. Обязательно провести вакцинацию домашних животных

Бешенство — инфекционное заболевание, вызываемое вирусом бешенства Rabies virus. Вирус бешенства вызывает специфический энцефалит (воспаление головного мозга) у животных и человека. Передаётся со слюной при укусе больным животным. Затем, распространяясь по нервным путям, вирус достигает слюнных желёз и нервных клеток коры головного мозга, гиппокампа, бульбарных центров, и, поражая их, вызывает тяжёлые необратимые нарушения.

Источник: Управление Федеральной службы по ветеринарному и фитосанитарному надзору по Томской области

Новосибирские медики опровергли информацию о вспышке вируса Коксаки

Врачи опровергли информацию о вспышке вируса Корсаки в Новосибирской области, о которой ранее сообщили СМИ. По данным инфекционистов, ни одного случая заболевания в этом году не зарегистрировано

Ни одного пациента с симптомами заражения вирусом Корсаки в этом году в инфекционную больницу не поступало, заявила главный врач детской больницы № 3 Татьяна Комиссарова. В свою очередь, в Роспотребнадзоре сообщили, что за текущий год не было ни одного извещения из новосибирских стационаров о подобных пациентах. В 2020 году в городе было зафиксировано два случая заболевания детей, в 2019 больных было много, маленькие пациенты поступали в инфекционную больницу с июня по октябрь.

Таким образом, медики отреагировали на информацию в местных СМИ о том, что в Новосибирске отмечена вспышка вируса Корсаки. Между тем, десятки родителей утверждают, что у детей появились характерные симптомы после отдыха в южных регионах России.

По словам инфекциониста Андрея Познякова, вирус Корсаки далеко не безобиден, как считают некоторые родители. В частности, у маленьких детей он поражает сердечные оболочки, что может привести к летальному исходу, пишет VN. ru.

Начинается болезнь, вызываемая вирусом Коксаки, с резкого повышения температуры, вплоть до 40 градусов, снижения аппетита и других признаков, напоминающих грипп. Главными же симптомами заражения является так называемая «болезнь рука-нога-рот». Она заключается в появление красной сыпи (иногда с волдырями), напоминающей ветрянку или герпес, на суставах рук и ног, ладонях, стопах и в области гениталий. Подробнее о том, что такое вирус Корсаки и чем он опасен, читайте в специальном материале «Царьград Новосибирск».

Уважаемые читатели Царьграда!

Присоединяйтесь к нам в соцсетях «ВКонтакте»Instagramfacebook, а также подписывайтесь на наш телеграм-канал t.me/tsargradnsk и канал в «Яндекс.Дзен». Если вам есть чем поделиться с редакцией «Царьград Новосибирск», присылайте свои наблюдения, вопросы, новости на электронную почту [email protected]

 

Мастерская Петра Фоменко: Вирус носорожьего гриппа

Внезапно посерьезнел и забился напряженной философско-социальной мыслью московский театр. Сейчас уже с полной ответственностью можно говорить о том, что темой нынешнего сезона станут социальные неврозы и мутации массового сознания, проблема свободы как таковой. Должно было пройти тридцать с лишним лет, чтобы этот сюжет вернулся в отечественный театр.

В конце года в театре «У Никитских ворот» его режиссер Марк Розовский поставил «Носорогов» Ионеско, философскую притчу о фашизме, массовом отуплении и личной свободе. Вслед за ним «Ленком» и Александр Морфов показали премьеру спектакля по мотивам культового романа Кена Кизи «Полет над гнездом кукушки» и назвали его «Затмение», обозначив свою тему как затмение разума, презревшего свободу, поддавшегося «норме», усредненности, анонимной власти белых воротничков. Морфов с Абдуловым рассказали простую и негероическую историю о тех, кто смертельно устал, кто в череде обретений и утрат успел наиграться и больше не знает, чего хотеть. О тех, в ком не осталось никакого желания революций и бунтов, но лишь простейшее, элементарное чувство справедливости и презрения к насилию.  О тех, кто беззаботно забыл, что их деды уже проходили такую историю, а когда вспомнил, было слишком поздно.

Только что — с разницей в две недели — Юрий Погребничко в театре «Около» рассказал историю самоубийства Кириллова из «Бесов» («Русский студент…»), а Кама Гинкас представил свои фантазии на темы «Легенды о Великом Инквизиторе» из «Братьев Карамазовых» («Нелепая поэмка»). И там, и там — мысль о свободе, о том, что она — не дешевый идеологический фетиш, а тяжелая духовная задача взрослого человека.

«Мне нужно было показать, почему в коллективном сознании возможна мутация и как она происходит»
Во всех этих спектаклях острота общественного высказывания — почти критическая. Их режиссеры, так или иначе, пережили оттепель, затем — новые холода и новые потепления. Но трудно было предположить, что Иван Поповски, со времен знаменитого «Приключения» — безусловный «эстет», «специалист» по поэтическому театру русских символистов, автор тонких оперных, музыкальных спектаклей, тоже станет режиссировать давнюю философско-социальную притчу Эжена Ионеско. Что и он обнаружит ее вновь набухшую злободневность.

Ионеско написал пьесу, в которой все начинается как фарс, а затем разворачивается как психологическая и философская драма. Сегодня, быть может, как никогда раньше, в герое «Носорогов» Беранже — пьянице и хранителе здравого смысла — видят Беранже-философа из последней и уж точно самой безысходной драмы Ионеско «Король умирает».

У Ивана Поповски Беранже играет Кирилл Пирогов — главный неврастеник фоменковской труппы. Начав спектакль как беззаботный весельчак из эксцентрически-фантастического фарса на темы превращения людей в носорогов, его Беранже приобретает к финалу совсем иные интонации — романтического героя-одиночки и истерзанного рефлексией интеллигента. Вариации героической, романтической драмы, драмы экзистенциальной и психологической волнами накатывают одна за другой на протяжении всего второго акта. Его достойной, огненно-темпераментной и героической партнершей становится его возлюбленная Дэзи (Наталью Вдовину специально на эту роль пригласили из «Сатирикона», где она давно ничего подобного по масштабу не играла). Она до последней минуты ведет себя как персонаж героико-романтический. Не просто красивое, но и по-настоящему крупное, яркое, как того требует стиль, лицо Натальи Вдовиной — Дэзи исполнено отчаянной решимости.

Кажется, что Поповски более всего волнует именно это смещение жанровых регистров. Он начинает спектакль среди белых французских фасадов (художник — Ангелина Атлагич), на фоне ясного синего неба, в яркой, комической оркестровке. Здесь ему и Галина Тюнина (Домашняя хозяйка, Мадам Беф) в помощь, и брат ее Никита Тюнин (мсье Папийон), только что пришедший в «Мастерскую» из лаборатории Анатолия Васильева, и Андрей Козаков (Ботар), и Карен Бадалов (Логик), и Алексей Колубков (Дюдар), и Олег Любимов (Жан, Лавочник). История про носорогов, в которых постепенно — один за другим — превращаются жители города, похожа поначалу на беззаботную французскую комедию. Но вот эпидемия становится все опаснее, и вместе с нашествием носорожьего «гриппа» в спектакль приходит подробность психологического диалога, оркестрованного в отчетливых романтических интонациях. Беранже-Пирогов нервничает все больше, и вот мы неожиданно узнаем в нем Мак Мерфи, героя Александра Абдулова в ленкомовском спектакле. Неврастеничный, пьющий паренек, лишенный героического, он просто не может, не успевает поддаться массовой истерии. 

Пространство белых фасадов и безоблачного неба сужается до двух стен, в которых заперты Беранже-Пирогов и Дэзи-Вдовина. Последние люди в носорожьей стае, они готовы претерпеть свое одиночество и здравомыслие до конца. Но вот и Дэзи побеждена, и, охваченная эпидемией птичьего — простите — носорожьего гриппа, она бежит к «своим», оставляя Беранже стенать по поводу своей нерасторопности. «Поздно, раньше надо было думать!» — восклицает он, пока мимо его стен величественно, точно божество, проплывает носорог. (Кстати, спектакль Поповски так и называется «Носорог», в единственном числе). Как и Мак Мерфи в «Ленкоме» он органически не принял «вирус», не успел инфицироваться, настаивая на своем человеческом, то есть индивидуальном, немассовидном, облике.

Программка цитирует слова Ионеско: «Меня за эту пьесу ругали. […] Потому, что не предложил выхода. Но мне и не нужно было предлагать выход. Мне нужно было показать, почему в коллективном сознании возможна мутация и как она происходит. Я просто описывал — феноменологически — процесс коллективного перерождения». Поповски именно эту феноменологию и реализует в своем новом спектакле.

опера «Царская невеста» в концертном исполнении

  • Иван Поповски: «Не надо бояться не быть в центре внимания»

    Inner Emigrant, «Ваш досуг», 8.04.2021

  • Выйти из сумрака

    Лариса Каневская, «Мнение», 23.03.2021

  • Увидеть – не значит понять

    Светлана Бердичевская, «Экран и Сцена», 18.12.2020

  • Поднимите ей веки

    Марина Шимадина, «Театрал», 31.10.2020

  • Самого главного глазами не увидишь: «Молли Суини» в Мастерской Петра Фоменко

    Юлия Зу, «Musecube», 29.10.2020

  • От какого театра мы отказываемся

    Марина Токарева, «Новая газета», 28.10. 2020

  • Спасение утопающих

    Елена Шаина, «Театр To Go», 24.10.2020

  • «Молли Суини» в Мастерской Фоменко: спектакль, который учит принимать мир, не глядя

    Inner Emigrant, «Ваш досуг», 23.10.2020

  • Иван Поповски выпустит спектакль по пьесе Брайана Фрила

    Екатерина Авдеева, «Театр.», 18.10.2020

  • Режиссер Евгений Каменькович: «Мне кажется, драматические театры будут вынуждены заниматься интернет-проектами»

    Ольга Романцова, «Культура», 14.07.2020

  • Открытие сезона 2017/18 в Мастерской Петра Фоменко

    Лариса Каневская, «Мнение», 13.09.2017

  • Иван Поповски: «Сумасшествие любви»

    Надежда Сикорская, «Наша газета», 11.09.2017

  • Карэн Бадалов: «Во сне мы свободны»

    Елена Губайдуллина, «Театральная Афиша», 11.2015

  • Сон в летнюю ночь

    Валентина Федорова, «Планета Красота, № 5-6», 10.2015

  • Чарующий «Сон…»

    Ирина Шведова, «Московская правда», 25.09.2015

  • Театр «Мастерская П. Фоменко»: легенды и триумфы

    Ольга Егошина, «http://kommersant. ru», 17.09.2015

  • Дыша духами и туманами

    Зоя Апостольская , «Российская газета», 15.09.2015

  • Честно заработанная шестипенсия

    Ольга Фукс, «Театральная Афиша», 08.2015

  • Укол счастьем

    Светлана Бердичевская, «Экран и Сцена», 31.07.2015

  • «Мир головокружительной свободы»

    Алексей Бартошевич, «Экран и Сцена», 31.07.2015

  • Сон в летнюю ночь

    Наталья Витвицкая, «Ваш досуг», 22.07.2015

  • Ночные забавы

    Мария Юрченко, «http://portal-kultura.ru», 22.07.2015

  • Это был не сон?

    Марина Шимадина, «http://ptj.spb.ru», 20.07.2015

  • Балканское барокко

    Павел Руднев, «www.teatrall.ru», 4.07.2015

  • Полет во сне и наяву: герои Шекспира совершили побег

    Елена Смородинова, «Вечерняя Москва», 3.07.2015

  • «Для каждого спектакля придумываем специальные механизмы»

    Елена Губайдуллина, «Сцена № 3 (2015)», 07.2015

  • Про эльфов и людей

    Антон Хитров, «Ведомости», 26.06.2015

  • «Зовут меня Рыло, я вышел на сцену…»

    Марина Токарева, «Новая газета», 24. 06.2015

  • Цирковые таланты пошли на пользу Шекспиру

    Григорий Заславский, «Независимая газета», 22.06.2015

  • Иван Поповски поставил «Сон в летнюю ночь»

    Алёна Витшас, «Русский блоггер», 21.06.2015

  • Где эта девочка, где этот дом?

    Петр Сейбиль, «http://vtbrussia.ru/», 12.03.2014

  • Русская классика завоевывает хорватскую сцену

    Артём Румянцев, «Трибуна», 24.10.2012

  • Спектакль Ивана Поповски стал лучшим в Хорватии

    «http://www.teatral-online.ru», 24.10.2012

  • Петр Фоменко: сороковины

    Марина Тимашева, «Радио «Свобода»», 18.09.2012

  • Чепуха

    Ася Волошина, «Петербургский театральный журнал, № 1 (63)», 02.2011

  • Сказка, просто сказка!

    Александр Соколянский, «Страстной бульвар № 1 (131)», 09.2010

  • Такая «Алиса» и Голливуду не снилась

    Маргарита Виноградова, «Эхо планеты», 21.07.2010

  • «Фоменки» завели Чеширского Кота

    Елена Дьякова, «Новая газета», 2.07.2010

  • Иван Поповски построил для Алисы Зазеркалье

    Ольга Фукс, «Вечерняя Москва», 1. 07.2010

  • «Алиса» без лишних смыслов

    Алла Шендерова, «infox.ru», 29.06.2010

  • Театр Фоменко заговорил со зрителями языком кино

    Ольга Романцова, «gzt.ru», 23.06.2010

  • «Алиса в Зазеркалье»: энциклопедия абсурда

    Марина Шимадина, «Ваш досуг», 23.06.2010

  • Алиса в Стране спецэффектов

    Марина Давыдова, «Известия», 23.06.2010

  • Алиса в иллюзиях и проекциях

    Майа Одина, «Газета.ru», 22.06.2010

  • Фокусы и чудеса Зазеркалья

    Ольга Егошина, «Новые Известия», 21.06.2010

  • Безумное чаепитие на Кутузовском

    Ада Шмерлинг, «Известия (Неделя)», 18.06.2010

  • Иван Поповски: «Стремлюсь, чтобы волшебство было в каждом спектакле»

    Светлана Полякова, «TimeOut», 24.05.2010

  • Рождество у Петра Фоменко, или Двадцать лет спустя

    Алексей Бартошевич, «OpenSpase.ru», 13.01.2010

  • Энциклопедия абсурда

    Елена Губайдуллина, «Энергия успеха № 2 (26)», 2010

  • «Времена… года…» в Театре Камбуровой

    Ольга Фукс, ««Вечерняя Москва»», 9. 02.2009

  • Тайны без слов

    Екатерина Кретова, ««МК»», 27.01.2009

  • Вокально-инструментальный перформанс

    Елена Ковальская, ««Афиша»», 20.01.2009

  • Фоменко почти без «фоменок»

    Елена Ковальская, «Афиша», 20.01.2009

  • Герои против плюшевых львов

    Ольга Романцова, «Газета», 14.01.2009

  • Во-первых, это красиво

    Глеб Ситковский, ««труд»», 14.01.2009

  • Сезонные прогулки

    Ольга Егошина, ««новые известия»», 13.01.2009

  • Партизаны Арденнского леса

    Елена Дьякова, «Новая газета», 12.01.2009

  • Театр — жизнь

    Галина Шматова, «Театральная Жизнь (№ 1, 2009)», 01.2009

  • Времена, года и музыка.

    Марина Мурзина, ««Планета красота»», 01.2009

  • «Времена …года». Театр музыки и поэзии п/р Елены Камбуровой

    Алиса Никольская, ««Кинопарк»», 12.2008

  • «ВРЕМЕНА┘ ГОДА. ..»

    Марина Гаевская, «Театральная афиша», 12.2008

  • «Времена… года…» в Театре музыки и поэзии п/р Е. Камбуровой

    Вячеслав Шадронов, «http://users. livejournal.com/_arlekin_/1271168.html», 21.11.2008

  • Путешествие по времени. С музыкой

    Ирина Шведова, ««Московская правда»», 12.11.2008

  • Красота против цивилизации

    Павел Руднев, ««Независимая газета»», 10.11.2008

  • Демисезонный спектакль

    Марина Шимадина, ««КоммерсантЪ»», 17.10.2008

  • Magical mystery tour

    Лев Семёркин, «www.teatr.ru», 16.10.2008

  • Жизнь человека

    Анатолий Фанталов, «www.teatr.ru», 15.10.2008

  • Иван Поповски: «Сегодняшние „Времена года“ звучали бы еще жестче»

    Ольга Фукс, ««Культпоход»», 10.2008

  • Совершенная магия, иллюзия, фантазия. ..

    Александра Бошковска, ««Дневник»», 7.08.2008

  • Билетов не достать. О спектакле-волшебстве Поповски.

    ««Нова Македония»», 5.08.2008

  • Блистательное выступление театра Елены Камбуровой из Москвы

    Симон Илиевски, ««Вестник»», 5.08.2008

  • Вневременные времена года

    Борче Грозданов, ««Вечер»», 5.08.2008

  • Ошеломляющая театральная магия

    М. Зафировска, ««Весть»», 5.08.2008

  • Театр новой эры — упоение чувств

    Нина Кепеска, ««Время»», 5.08.2008

  • «Концерт без слов» заставил публику онеметь

    Пелагия Младеновска, ««Шпиц»», 5.08.2008

  • Бацилла театра

    Анастасия Борисенкова, «WHERE MOSCOW», 02.2008

  • Попытка полета

    Наталья Старосельская, ««Страстной бульвар, 10»», 01.2008

  • Елена Камбурова. Успех

    Ксения Ларина, «Эхо Москвы», 16.04.2007

  • Двое на корриде

    Дмитрий Морозов, «Культура», 5.04.2007

  • Иван Поповски: «Разгадать „Кармен“ невозможно»

    Елена Губайдуллина, «Новые известия — Театрал», 30.03.2007

  • Несчастная доля Дона Хозе

    Елена Губайдуллина, «Новые известия — Театрал», 30.03.2007

  • Эти глаза напротив. ..

    Марина Гайкович, «Независимая газета», 20.03.2007

  • Дон Жуан в юбке

    Ольга Романцова, «Новые Известия», 19.03.2007

  • Только раз бывает в жизни встреча

    Екатерина Кретова, «Московский Комсомолец», 19. 02.2007

  • Дирижерский театр

    Петр Поспелов, «Ведомости», 16.02.2007

  • Римский-Корсаков: опера «Царская невеста» в концертном исполнении

    Екатерина Бирюкова, «Афиша», 6.02.2007

  • Господа пошутили

    Ирина Алпатова, «Культура», 23.11.2006

  • Сталь и хрусталь

    Ольга Фукс, «Вечерняя Москва», 22.11.2006

  • Семейное счастье

    «Итоги», 13.11.2006

  • Мощная энергия и великолепные постановки

    Лильяна Мазова, ««Дневник», Македония», 26.07.2006

  • На сцене я побеждаю силу земного притяжения

    Сребра Пашовска, ««Дневник», Македония», 19.07.2006

  • Охридское лето

    ««Дневник», Македония», 19.07.2006

  • Русские музыкальные одиссеи Ивана Поповского и Зои Бузалковской

    Лильяна Митевска, ««Вестник», Македония», 15.07.2006

  • Большая программа Московского Театра Елены Камбуровой

    ««Дневник», Македония», 15.07.2006

  • Грёзы в сотый раз

    ««Россия»», 8.06.2006

  • По улице ходили «Носороги»

    Любовь Лебедина, «Труд», 22. 03.2006

  • Не шутите с носорогом

    Ирина Алпатова, «Культура», 16.03.2006

  • Носороги среди нас

    Григорий Заславский, «Независимая газета», 15.03.2006

  • В мире животных

    «Итоги», 13.03.2006

  • Сопротивление носорожеству

    Майя Стравинская, «Коммерсант», 10.03.2006

  • Носороги беспокоят

    Олег Зинцов, «Ведомости», 10.03.2006

  • Вирус носорожьего гриппа

    Алена Карась, «Российская газета», 7.03.2006

  • Рогатая экзотика

    Ольга Егошина, «Новые Известия», 7.03.2006

  • Бактерия риноцерита

    Александр Соколянский, «Время новостей», 7.03.2006

  • Все мы немножко носороги

    Глеб Ситковский, «Газета Gzt.Ru № 38», 7.03.2006

  • Носорог-рог-рог идет

    Марина Давыдова, «Известия», 6.03.2006

  • Джаз побеждает Малера

    Ольга Фукс, «Вечерняя Москва», 6.02.2006

  • «Абсент»

    Марина Гаевская, «Театральная Афиша», 12.2005

  • Зелененький

    Влада Гончарова, «TimeOut», 12.09.2005

  • Океан очарования и… абсента

    Светлана Осипова, ««Театральная касса»», 09. 2005

  • Любители абсента

    Александр Черный, ««Московские новости»», 8.07.2005

  • «Закажите мне мартини и абсент»

    Ирина Шведова, ««Московская правда»», 8.07.2005

  • Зеленые феи в плену у зеленого змия

    Мария Зерчанинова, ««Вечерняя Москва»», 1.07.2005

  • Когда-то в Париже…

    Аркадий Петров, ««Культура»», 30.06.2005

  • Фокстрот, канкан, абсент

    Олег Зинцов, ««Ведомости»», 29.06.2005

  • Летя на зеленый свет

    Глеб Ситковский, ««Газета»», 21.06.2005

  • Кабаре «Зеленая фея»

    Ольга Романцова, ««Досуг и развлечения»», 16.06.2005

  • Затишье перед нашествием

    Дина Годер, ««Русский журнал»», 30.05.2005

  • Между Абсентом и Грезами

    Людмила Милькова, ««Удобная газета»», 24.05.2005

  • Зелен, аж жуть

    ««Итоги»», 19.04.2005

  • Абсент — страшная сила

    Майя Стравинская, «Коммерсантъ», 6.04.2005

  • То ли явь, то ли сон, не пойму

    Оксана Мерзликина, ««Московская правда»», 5.03.2004

  • Грезы. Постскриптум.

    Юлия Маринова, ««Театральная жизнь»», 06.2003

  • «Грезы» в театре Елены Камбуровой

    Андрей Лавров, «„Эспрессо“ итальянская газета в Москве», 15.05.2003

  • Стихи и мечты Ивана Поповски

    Григорий Заславский, «Независимая газета», 18.04.2003

  • Ах, эти «Грезы…»

    Геннадий Демин, ««Литературная Газета»», 5.03.2003

  • «Ах, эти Грезы┘»

    Кира Владина, «Литературная Газета», 5.03.2003

  • Необычный вариант

    Ольга Романцова, ««Политбюро»», 24.02.2003

  • Шалости муз

    Елена Губайдуллина, ««Ваш Досуг»», 3.02.2003

  • Воплощенные грезы любви

    Ольга Кучкина, ««Комсомольская правда»», 2003

  • Фламенко Шуберту не помеха

    Аркадий Петров, ««Вечерняя Москва»», 2003

  • Балканский синдром

    Елена Ковальская, «Афиша», 24.06.2002

  • Спектакли для всех и┘ только для своих

    Тамара Сергеева, «24», 1.11.1994

  • Вознесение кукол

    Александр Соколянский, 1994

  • Добрые игры в недобром мире

    Наталья Крымова, 05. 1993

  • Театр от Фомы

    Юрий Зерчанинов, 1993

  • «Грезы» в балаганчике

    Ирина Лукьянова, «„Молодежь Московии“»,

  • Грезы четырех нимф

    Ольга Галахова, «„Дом актера“»,

  • Во сне я горько плакал

    Елена Дьякова, «„Новая Газета“»,

  • Романтизм за занaвеской

    Любовь Авдеева, ««Вечерний клуб»»,

  • 28 сентября – ВСЕМИРНЫЙ ДЕНЬ БОРЬБЫ С БЕШЕНСТВОМ

    Бешенство – это острое вирусное инфекционное заболевание, от которого в мире каждые десять минут погибает по одному человеку. В России смертность населения от бешенства относительно невелика. Однако, из-за глобального распространения, 100%-й летальности, безнадёжности лечения уже развившегося заболевания, огромного психологического воздействия, большого экономического ущерба бешенство имеет важное социально-экономическое значение. По оценке Всемирной организации здравоохранения бешенство входит в пятёрку самых экономически затратных инфекционных болезней.

    Ежегодно в нашей стране по поводу укусов животными к врачам-травматологам обращаются около 400 тыс. человек, из которых каждый третий – ребенок. Около 300 тыс. получают назначение на профилактическую вакцинацию.

     

    Бешенство поражает центральную нервную систему, является абсолютно летальным и характеризуется отсутствием средств лечения уже развившегося заболевания.

     

    Несмотря на это, бешенство можно предотвратить при помощи соблюдения правил поведения при контакте с дикими и домашними животными и вакцинопрофилактики!

     


     

    Источники инфекции

    Хотя к бешенству чувствительны все теплокровные животные (млекопитающие и птицы), вирус циркулирует только в популяциях хищных и рукокрылых (летучие мыши).

    Основным источником вируса на территории России являются домашние (собака, кошка) и дикие животные (лисица, енотовидная собака, волк, корсак, барсук, песец, летучая мышь). Редко, но возможно заражение от контактов с другими животными (корова, овца, лошадь, крыса и др.). Например, можно заразиться от коровы, полагая, что она подавилась, и, обследуя её ротовую полость на наличие посторонних предметов.

     

    Возможные пути заражения бешенством

    Вирус проникает в организм через повреждённые кожные покровы и через слизистые оболочки. Заражение происходит при укусе или царапинах, нанесенных больным животным. Ослюнение бешеным животным свежих ран и порезов на коже человека, а также попадание на поврежденную кожу инфицированной мозговой ткани при вскрытии трупа бешеного животного, ведут к передаче вируса. Это же относится к попаданию брызг инфицированного материала (слюна, мозговая ткань) на слизистые оболочки (например, глаза, ротовая и носовая полости). Можно заразиться и при снятии шкур с бешеных зверей.

     

    Как отличить бешеное животное

    Заболевание животных может проявляться как в буйной, так и в тихой (паралитической) формах. Больная собака угнетена, забирается в темный угол, не откликается на зов хозяина, хрипло лает, грызет палки, глотает камни, изо рта обильно течет слюна, появляется рвота, косоглазие, отказывают задние лапы. Собака может в дикой злобе кидаться на всех подряд и бежать, не разбирая дороги. При бешенстве в тихой форме собака может виновато ластиться к хозяину, а потом как бы случайно укусить его. Может, убежать из дома. Наблюдается неадекватное поведение. Боязни воды (гидрофобии) у собаки может не быть, и вода, поставленная перед животным, не является достоверной проверкой его здоровья. Кошки, тоже могут болеть буйно и тихо. Буйство их очень опасно. Бешеная кошка прыгает людям на голову, грызет, кусает и царапает все, что попадается на дороге. Кошка может тихо забраться в подвал или под диван и укусить человека, когда ее будут вытаскивать.

     

    Бешеная лисица забегает в поселки, залезает в сараи, кусает скот, дерется с собаками. Она может выйти на дорогу и стоять, не обращая внимания на людей. Но если к ней подойти, почти всегда бросается на человека. Она может вести себя совершенно спокойно, позволяет взять на руки и принести домой. Больная енотовидная собака чаще всего затаивается и лежит неподвижно. Трогать такое животное, класть его в багажник и привозить домой очень опасно. Особенно страшен бешеный волк, наносящий множественные глубокие укусы, часто в голову. Нельзя подбирать летучих мышей и ловить их. Больная летучая мышь может укусить человека и улететь. Даже поверхностные, почти невидимые укусы летучих мышей ведут к передаче вируса.

    Бешеные коровы ревут, отказываются от еды, зевают, бросаются на стены. Больные овцы и козы прыгают на стены и кусают других животных, бросаются на людей и на собак. Водобоязни у них нет. Больные копытные, если даже у них нет видимой агрессии, могут иметь испуганный взгляд, отвисшую челюсть и выглядеть для хозяина как «подавившиеся косточкой».

    В отдельных, казуистически редких случаях, вирус бешенства обнаруживали у крыс, обыкновенных хомяков, сусликов. Роль мелких грызунов, насекомоядных (ежи), зайцеобразных в качестве резервуара вируса бешенства в настоящее время не доказана, несмотря на постоянное внимание учёных к этой проблеме.

     

    Меры по предупреждению инфицирования людей бешенством

    1.    Избегайте контактов с дикими животными, особенно с хищными! Категорически запрещено контактировать с дикими животными, которые кажутся миролюбивыми, спокойными, ласковыми! Нельзя кормить с рук лисёнка, который вышел к костру, нельзя гладить спокойно лежащую лисицу, корсака, енотовидную собаку, барсука. Нельзя приносить животное домой, садить в клетку и содержать дома! Нельзя оставлять детей без присмотра и допускать их до животного. Надо объяснять детям то, что нельзя подбирать летучих мышей, которые могут внезапно упасть на детскую площадку, оказаться в нишах дома или школы, нельзя ловить летучую мышь, случайно залетевшую в окно. Необходимо предпринять все возможные меры, чтобы избежать подобных контактов. Нельзя охотиться на диких животных с невакцинированными собаками. При снятии шкуры с промысловых видов, охотникам, таксидермистам, любителям и др. необходимо пользоваться одноразовыми перчатками, которые потом сжечь. При этом нужно использовать отдельную рабочую одежду, которую после работы снимать в перчатках и кипятить. Надо защищать лицо от попадания слюны, мозговой ткани и иных тканей животного, используя очки и маску.

    В районах, неблагополучных по бешенству диких животных, в основном лисиц, органы власти могут организовывать отстрел диких животных независимо от сроков охоты. Может быть проведена работа по профилактике болезни у этих животных путем разбрасывания возле их нор приманки, начиненной вакциной от бешенства.

    2.    Избегайте контактов с безнадзорными собаками и кошками! Не оставляйте детей без присмотра на улице, где могут находиться безнадзорные собаки или кошки. Объясните, что нельзя гладить, кормить, подпускать к себе чужих животных, они могут быть больны.

    Меры профилактики заболеваний животных бешенством.

    Все владельцы собак и кошек должны обязательно привить их от бешенства. Прививки в государственных лечебницах делаются бесплатно. Выводить собак на прогулки разрешается только на коротком поводке, а бойцовых или крупных — в наморднике, и оберегать их от контактов с бездомными животными. Продавать, покупать собак и кошек и перевозить их за пределы области разрешается только при наличии ветеринарного свидетельства.

     

    Что нужно делать, если контакт с животным произошёл

    Если животное укусило или поцарапало человека, немедленно обильно промойте рану, царапины и все места, на которые попала слюна, мыльным раствором не менее 15 мин., затем водопроводной водой, с последующей обработкой раствором перекиси водорода. Обработать края раны 5% настойкой йода. После этого необходимо как можно скорее обратиться в травмпункт по месту жительства к врачу-травматологу, который при необходимости, назначит курс профилактических прививок. Прививки это единственное средство спасения от бешенства! Уколы ставят в день обращения, а затем на 3, 7, 14, 30, 90 дни после укуса. Во время такого лечения категорически запрещено употреблять алкоголь. Если человека укусила своя или знакомая собака или кошка без явных признаков бешенства, то её можно подвергнуть карантинному наблюдению в течение 10 дней, исключив прямой контакт с этим животным. Это не отменяет необходимости обратиться к врачу и начать профилактические прививки в первый же день. Если собака или кошка остается здоровой в течение 10 дней после укуса, прививки прекращают. Но если животное погибло или убежало, то прививки необходимо продолжать. Для животных других видов срок карантинного наблюдения не установлен. Если такое животное не удается умертвить и представить в ветлабораторию для диагностики бешенства, прививки необходимо проводить в полном объеме.

     

    Бешенство слишком страшное заболевание, чтобы относиться к нему беспечно. Помните об этом!


    Клонирование и анализ гена PRNP Vulpes corsac на плато Цинхай, Китай

    Прион. 2020; 14(1): 20–23.

    Xue-Hua Yang

    a Ключевая государственная лаборатория профилактики и контроля инфекционных заболеваний, Совместный инновационный центр диагностики и лечения инфекционных заболеваний (Чжэцзянский университет), Национальный институт контроля и профилактики вирусных заболеваний, Китайский центр контроля заболеваний и профилактики, Пекин, Китайская Народная Республика

    Кан Сяо

    a Ключевая государственная лаборатория по профилактике и контролю инфекционных заболеваний, Совместный инновационный центр диагностики и лечения инфекционных заболеваний (Чжэцзянский университет), Национальный институт по контролю за вирусными заболеваниями и Профилактика, Китайский центр по контролю и профилактике заболеваний, Пекин, Китайская Народная Республика

    Yuezhang Wu

    a Государственная ключевая лаборатория по профилактике и контролю инфекционных заболеваний, Совместный инновационный центр диагностики и лечения инфекционных заболеваний (Чжэцзянский университет), Национальный институт V Контроль и профилактика инфекционных заболеваний, Китайский центр по контролю и профилактике заболеваний, Пекин, Китайская Народная Республика

    Липин Гао

    a Государственная ключевая лаборатория по профилактике и контролю инфекционных заболеваний, Совместный инновационный центр диагностики и лечения инфекционных заболеваний ( Чжэцзянский университет), Национальный институт по контролю и профилактике вирусных заболеваний, Китайский центр по контролю и профилактике заболеваний, Пекин, Китайская Народная Республика

    Dongdong Chen

    Диагностика и лечение инфекционных заболеваний (Чжэцзянский университет), Национальный институт контроля и профилактики вирусных заболеваний, Китайский центр контроля и профилактики заболеваний, Пекин, Китайская Народная Республика Профилактика и контроль заболеваний, C совместный инновационный центр диагностики и лечения инфекционных заболеваний (Чжэцзянский университет), Национальный институт контроля и профилактики вирусных заболеваний, Китайский центр контроля и профилактики заболеваний, Пекин, Китайская Народная Республика

    b Центр глобального общественного здравоохранения, Китай Центр по контролю и профилактике заболеваний, Пекин, Китай

    c Центр меганаук по биобезопасности Китайской академии наук, Ухань, Китайская Народная Республика

    Qi Shi

    Контроль, Центр совместных инноваций по диагностике и лечению инфекционных заболеваний (Чжэцзянский университет), Национальный институт по контролю и профилактике вирусных заболеваний, Китайский центр по контролю и профилактике заболеваний, Пекин, Китайская Народная Республика

    a Государственная ключевая лаборатория инфекционных заболеваний Профилактика и контроль заболеваний, Центр совместных инноваций ter диагностики и лечения инфекционных заболеваний (Чжэцзянский университет), Национальный институт контроля и профилактики вирусных заболеваний, Китайский центр контроля и профилактики заболеваний, Пекин, Китайская Народная Республика

    b Центр глобального общественного здравоохранения, Китайский центр Контроль и профилактика заболеваний, Пекин, Китай

    c Центр меганауки по биобезопасности Китайской академии наук, Ухань, Китайская Народная Республика

    Xiao-Ping Dong moc. [email protected], Государственная ключевая лаборатория профилактики и контроля инфекционных заболеваний, Совместный инновационный центр диагностики и лечения инфекционных заболеваний (Университет Чжэцзян), Национальный институт контроля и профилактики вирусных заболеваний, Китайский центр контроля и профилактики заболеваний, Чанг-Бай роуд 155, Пекин 102206, Китайская Народная Республика

    Поступила в редакцию 27 июля 2019 г.; Пересмотрено 24 ноября 2019 г .; Принято 30 ноября 2019 г.

    Copyright © 2019 Автор(ы). Опубликовано Informa UK Limited, торгующей как Taylor & Francis Group.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии, что оригинальная работа правильно цитируется.

    РЕФЕРАТ

    Ген PRNP кодирует белок PrP, который является консервативным у разных видов и связан с предрасположенностью к прионным заболеваниям. В этом отчете мы клонировали и секвенировали полноразмерный ген PRNP Vulpes corsac на плато Цинхай, Китай.Аминокислотная последовательность Vulpes corsac PrP показала 100% гомологию с таковой у трех других видов лисиц. Также анализировали родство таксонов Vulpes corsac PrP с другими видами животных, включая человека, собак, крупного рогатого скота, cervus, capra, ovis, верблюда, кошачьего, Mustela, мыши и хомяка.

    КЛЮЧЕВЫЕ СЛОВА: PRNP , Vulpes corsac , прионовая болезнь, плато Цинхай млекопитающие, включая человека [ 1 , 2 ].Преобразование нормальной и неинфекционной клеточной формы прионного белка хозяина (PrP C ) в аномальную и патогенную форму (PrP Sc ) имеет решающее значение для прионной болезни [ 3 ]. Прионный белок (PrP) кодируется геном-хозяином, а именно PRNP , обычно содержит одну открытую рамку считывания (ORF) [ 4 ]. Несмотря на то, что последовательность PRNP достаточно консервативна среди разных видов животных, полнота аллеля PRNP тесно связана с восприимчивостью к инфекциям различных прионных штаммов как в естественных, так и в экспериментальных условиях [ 5 8 ].

    Vulpes corsac принадлежит к виду лисиц, который в основном населяет степные, пустынные и полупустынные районы и распространен в Центральной Азии, простираясь до Монголии и северного Китая [ 9 ]. У этого вида животных есть три подвида, включая Vulpes corsac corsac, Vulpes corsac kalmykorum и Vulpes corsac turcmenicus [ 10 ]. В этом отчете мы описали полную длину гена PRNP Vulpes corsac , которая была поймана на плато Цинхай, Китай.

    Последовательность

    Vulpes corsac PrP

    Геномную ДНК из ткани печени лисы корсака естественной смерти, собранной в провинции Цинхай, экстрагировали с помощью QIAamp DNA Mini Kit. Последовательность PRNP амплифицировали методом ПЦР с разработанными праймерами (праймер выше: 5`-ATGGTGAAAAGCCACATAG-3`; праймер ниже: 5`-TCATCCCACTATCAAGAGA-3) на основе последовательностей PRNP Vulpes vulpes ({ «type»:»entrez-нуклеотид»,»attrs»:{«текст»:»EF571898″,»term_id»:»146760830″,»term_text»:»EF571898″}}EF571898), Vulpes velox ({» type»:»entrez-нуклеотид»,»attrs»:{«text»:»EU341513″,»term_id»:»169245389″,»term_text»:»EU341513″}}EU341513) и Vulpes lagopus ({«type «:»entrez-нуклеотид»,»attrs»:{«текст»:»EU365392″,»term_id»:»164685013″,»term_text»:»EU365392″}}EU365392) на веб-сайте NCBI.Условия реакции: 94°С в течение 1 мин, 52°С в течение 30 с, 72°С в течение 40 с, всего 35 циклов. После очистки продукт ПЦР встраивали в клонирующий вектор pMD19 и секвенировали с помощью праймера, сконструированного в соответствии с последовательностью клонирующего вектора.

    Согласно результатам секвенирования, последовательность PRNP тестируемого Vulpes corsac имела длину 774 п. н., что может кодировать 257 аминокислот (представлено в NCBI, {«type»:»entrez-нуклеотид»,»attrs» :{«текст»:»MN381732″,»term_id»:»1789811771″,»term_text»:»MN381732″}}MN381732).По сравнению с опубликованными данными о лисицах, включая рыжую лисицу, стрижа и песца, аминокислотная последовательность Vulpes corsac PrP была гомологична на 100%. Гомология Vulpes corsac PrP с человеком и другими видами животных также была проиллюстрирована на филогенетическом дереве (, рис. 1(a )). Он выявил чрезвычайно тесную гомологию с собачьим PrP ({«type»:»entrez-protein»,»attrs»:{«text»:»NP_001013441″,»term_id»:»165973348″,»term_text»:»NP_001013441″} }NP_001013441), при этом явно отдаленная связь с PrP человека ({«type»:»entrez-protein»,»attrs»:{«text»:»NP_898902″,»term_id»:»34335270″,»term_text»: «NP_898902»}}NP_898902).Между тем, последовательности PrP Vulpes corsac , а также других лисиц и собак также показали отдаленную связь с таковыми у видов животных с естественными прионными заболеваниями, таких как крупный рогатый скот ({«type»:»entrez-protein», «attrs»:{«text»:»ABE02802″,»term_id»:»90970315″,»term_text»:»ABE02802″}}ABE02802), ovis ({«type»:»entrez-protein»,»attrs»: {«text»:»NP_001009481″,»term_id»:»57164159″,»term_text»:»NP_001009481″}}NP_001009481, {«type»:»entrez-protein»,»attrs»:{«text»:»NP_001301176 «,»term_id»:»936976293″,»term_text»:»NP_001301176″}}NP_001301176), cervus ({«type»:»entrez-protein»,»attrs»:{«text»:»QAU19537″,»term_id «:»1562121111″,»term_text»:»QAU19537″}}QAU19537, {«type»:»entrez-protein»,»attrs»:{«text»:»AAT72295″,»term_id»:»50261248″,» term_text»:»AAT72295″}}AAT72295), кошка ({«type»:»entrez-protein»,»attrs»:{«text»:»ACA50727″,»term_id»:»169245362″,»term_text»:» ACA50727″}}ACA50727), хорек ({«type»:»entrez-protein»,»attrs»:{«text»:»XP_0121″,»term_id»:»8596″,»term_te xt»:»XP_0121″}}XP_0121) и верблюд ({«type»:»entrez-protein»,»attrs»:{«text»:»AUM59985″,»term_id»:»1321100604″,»term_text»:» AUM59985″}}AUM59985), а также животные с экспериментальными прионными заболеваниями, такие как мыши ({«type»:»entrez-protein»,»attrs»:{«text»:»NP_001265185″,»term_id»:» 506326231″,»term_text»:»NP_001265185″}}NP_001265185) и хомяк ({«type»:»entrez-protein»,»attrs»:{«text»:»AAA37013″,»term_id»:»387056″,» term_text»:»AAA37013″}}AAA37013).

    Анализ гомологии аминокислотных последовательностей белков PrP человека и различных видов животных. (а). Филогенетическое дерево. (б). Матрица гомологии.

    Матрица гомологии человека, Vulpes corsac и других видов млекопитающих проиллюстрирована на Рисунок 1(b ). Помимо собачьего PrP, демонстрирующего гомологию 99,2%, PrP Vulpes corsac показал 95,6% гомологию с PrP Mustela putorius , 94,4% с кошачьим, 94,0% с ovis, 92,7% с Cervus nippon , 92.72.3% с Bos taurus , 91,9% с Cervus elaphus , 89,9% с верблюдом, 87,1% с мышью и хомяком и 86,7% с человеком.

    Точные различия последовательностей PrP у разных видов показаны на Рис. 2 . Как и у лисы, PrP собак состоял из 257 аминокислот. Между лисой и собакой различались только две аминокислоты, расположенные в положении аа 101 от Gly (лиса) до Ser (собака) и в положении аа 163 от Asp (лиса) до Glu (собака), что указывает на высокую гомология PrP внутри семейства собачьих. PrP человека состоит из 253 аминокислот. Между Vulpes corsac и человеком было 36 аминокислотных различий в пептидах PrP. Области с большим количеством расхождений в аминокислотах между PrP лисицы и человека представляли собой N-концевую сигнальную последовательность (39,2%) и С-концевую якорь GPI (22,7%). Аминокислотные вариации также были идентифицированы в областях α3 (22,7%) и α2 (9,1%), но не в областях α1, β1 и β2. Дальнейшее сравнение последовательности PrP Vulpes corsac с последовательностями PrPs крупного рогатого скота и cervus также выявило сходные модели изменчивости.Помимо различий в областях сигнального пептида и якоря GPI, также были обнаружены вариации в областях α3 (18,1%) и α2 (9,1%), но не в областях α1, β1 и β2.

    Сравнение вариантов аминокислот белков PrP человека и различных животных. Различные функциональные и вторичные структурные области в последовательностях PrP обозначены цветом. Номера аминокислот указаны справа.

    Обсуждение

    В этом отчете мы впервые описали последовательность PRNP Vulpes corsac на плато Цин-Тобент. Vulpes corsac принадлежит к семейству псовых, подсемейству лисиц, роду лисиц. Как правило, животные семейства собачьих не чувствительны к прионной инфекции. До сих пор не сообщалось о естественном ТГЭ у собак [ 11 , 12 ], включая животных Vulpes. Среди факторов, которые могут способствовать восприимчивости или резистентности к прионным штаммам, последовательность хозяина PrP считается наиболее существенной. Высокая идентичность последовательности PRNP между Vulpes corsac и собакой указывает на то, что Vulpes corsac также может быть нечувствительным к прионной инфекции.

    Vulpes corsac широко распространен в различных географических регионах Центральной Азии и западного региона Китая, обычно потребляя в качестве основного источника пищи грызунов и птиц, таких как желтая мышь, полосатый хомяк и полевка Брандта. Между тем, многие другие хищники могут охотиться на Vulpes corsac , таких как каракал, шакал и т. д. Плато Цинхай-Тибет является важным пастбищным районом в Китае. Есть тысячи голов домашнего скота, например, яков, овец и коз, а также диких травоядных, например.g., тибетская антилопа, кианг, дикий як, монгольский джейран и др. В качестве среднего звена пищевого цикла в особой географии занижение последовательности Vulpes corsac PrP может помочь оценить его потенциал в циркуляции прионов, например , скрепи, в особом регионе.

    Заявление о финансировании

    Эта работа была поддержана исследовательским проектом [2018ZX10711001, 2017YFC1200500], грантами Китайского национального фонда естественных наук [81572048, 81630062] и грантом на развитие SKLID [2019SKLID501, 2019SKLID1093, 2019SKLID1093, 2006].

    Заявление о раскрытии информации

    Авторы не сообщали о потенциальном конфликте интересов.

    Ссылки

    [1] Colby DW, Prusiner SB.. Прионы [J]. Колд Спринг Харб Перспект Биол. 2011;3(1):13363–13383. [Google Scholar][3] Вестергард Л., Кристенсен Х. М., Харрис Д.А. Клеточный прионовый белок (PrP(C)): его физиологическая функция и роль в заболевании[J]. Биохим Биофиз Акта. 2007;1772(6):629–644. [Бесплатная статья PMC] [PubMed] [Google Scholar][4] Prusiner SB. Молекулярная биология прионных болезней[J].Наука. 1991;252(5012):1515–1522. [PubMed] [Google Scholar][5] Hadlow WJ, Race RE, Kennedy RC. Экспериментальное заражение овец и коз вирусом трансмиссивной энцефалопатии норок.[J]. Can J Vet Res Revue canadienne de recherche vétérinaire. 1987; 51(1):135. [Бесплатная статья PMC] [PubMed] [Google Scholar][6] Hanson RP, Eckroade RJ, Marsh RF, et al. Восприимчивость норок к овечьему скрепи [J]. Наука. 1971; 172 (3985): 859–861. [PubMed] [Google Scholar][7] Робинсон М.М., Хэдлоу В.Дж., Хафф Т.П. и др. Экспериментальное заражение норок губчатой ​​энцефалопатией крупного рогатого скота.[Дж]. Джей Ген Вирол. 1994; 75 (часть 9): 2151. [PubMed] [Google Scholar][8] Robinson MM, Hadlow WJ, Knowles DP, et al. Экспериментальное заражение крупного рогатого скота возбудителями трансмиссивной энцефалопатии норок и скрепи[J]. J Комп Патол. 1995;113(3):241–251. [PubMed] [Google Scholar][9] Мердок Д.Д. 2014. Vulpes corsac. Красный список МСОП видов, находящихся под угрозой исчезновения, 2014 г .: e.T23051A546. [ЭБ/ПР]. [цитировано 7 июля 2019 г.]. Доступна с: https://www.iucnredlist.org/en[11] Sanchez-Garcia J, Fernandez-Funez P. D159 и S167 представляют собой защитные остатки в прионном белке собаки и лошади, двух устойчивых к прионам животных[J].Нейробиол Дис. 2018; 119:1–12. [Бесплатная статья PMC] [PubMed] [Google Scholar][12] Won SY, Kim YC, Kim K и др. Первое сообщение о полиморфизмах и генетических особенностях гена прионоподобного белка (PRND) у устойчивого к прионным болезням животного, собаки [J]. Int J Mol Sci. 2019;20(6):1404. [Бесплатная статья PMC] [PubMed] [Google Scholar]

    Vulpes — обзор | ScienceDirect Topics

    Taenia crassiceps (Zeder, 1800) Rudolphi, 1810
    Биология и жизненный цикл

    См. описание этого рода, а также характеристики, используемые для различения видов, как предусмотрено для T. гидатигена .

    См. общее описание жизненного цикла этого рода, приведенное для T. hydatigena . Для Taenia crassiceps применяется тот же общий жизненный цикл со следующими особенностями, характерными для этого вида:

    Verster 44 указывает окончательных хозяев T. crassiceps как Vulpes spp. и Aropex spp. Т. crassiceps встречаются в северном полушарии. Промежуточными хозяевами для T выступают различные грызуны и зайцеобразные.крассицепс . 44 Тип личиночной стадии промежуточного хозяина – цистицерк. 45

    Метод(ы) выращивания

    Личинки T. crassiceps удаляли в асептических условиях у мышей, убитых смещением шейных позвонков. Личинок выращивали in vitro до стадии стробилов в системе культивирования, состоящей из 100 частей среды 858, 25 частей термоинактивированной FCS и 12,5 частей 5% дрожжевого экстракта. Среду также обогащали добавлением глюкозы, KCl, пенициллина и стрептомицина.

    Жидкую фазу наслаивали на твердую основу (коагулированную бычью сыворотку) и газировали добавлением 10% O 2 +5% CO 2 в N 2 или 10% CO 2 в N 2 . Проводили соответствующую обработку кисло-пепсином и панкреатин-трипсином-таурохолатом натрия, после чего стимулированные цистицерки вносили в культуральные сосуды на водяной бане-качалке при 38°С. Было обнаружено, что T. crassiceps требует присутствия фракции сывороточного глобулина в FCS, чтобы происходил любой вид морфогенеза. 95

    Изолированные T. crassiceps клетки цистицерков, полученные путем трипсинизации, сохраняли в культуре до 15 дней. При введении ИП восприимчивым мышам полные цистицерки восстанавливались в количестве, пропорциональном количеству инъецированных клеток. 96 Напротив, введение клеток резистентным мышам C57BL/6J не приводило к восстановлению полных кист. Самки мышей BALB/c естественно более восприимчивы, чем самцы, к экспериментальному заражению IP T. крассицепс метацестоды. 97

    Т. crassiceps можно поддерживать в лаборатории путем серийного пассирования метацестод у грызунов и особенно у мышей. Метацестоды у крыс не размножаются. 98 Тем не менее, молодые и старые самцы и самки крыс с капюшоном были экспериментально инфицированы IP примерно 150 метацестодами (~3 личинки/г массы тела хозяина). Затем их кормили измельченной пищей, состоящей либо из немедикаментозного корма, либо из корма, содержащего 0,01% гидрокортизона, в течение 18 дней.Вскрытие инфицированных крыс через 56–57 дней ИП выявило инфекции у нелекарственных и леченных крыс со значительно более высоким размножением личинок у хозяев любого пола с ослабленным иммунитетом. 99 Крысы-альбиносы (Sprague-Dawley) также поддерживают размножение метацестод T. crassiceps .

    Метацестоды T. crassiceps можно поддерживать с помощью внутрибрюшинного серийного пассажа у мышей и монгольских песчанок ( Meriones unguiculatus ). Также сообщалось о развитии цистицерков в зрелых ленточных червей в кишечном тракте золотистых хомяков, получавших и не получавших лечение кортизоном. 100 Инфицированные песчанки в возрасте около 9 месяцев PI были вскрыты для сбора метацестод. Золотистым хомячкам перорально инокулировали 200 зрелых цистицерков и обрабатывали подкожно ацетатом кортизона в дозе 150 мг/кг в день заражения, 100 мг/кг 4-дневный ИП и 50 мг/кг в ТД 8, 12, 16, 20. , 24 и 30 PI или не лечились. На TD 28 PI яйца T. crassiceps были обнаружены в фекалиях необработанных и обработанных кортизоном хомяков. Вскрытие хомяков проводили на TD 21, 28 и 40 PI.Взрослые ленточные черви были обнаружены как у необработанных, так и у обработанных кортизоном хомяков, но восстановление и выживание ленточных червей были более длительными у хомяков, получавших кортизон.

    Среды определенного химического состава также использовались для поддержания личинок T. crassiceps . 101 Личинки, содержавшиеся в EMEM после ферментативного переваривания, выживали в течение максимального периода 33 дня, оставались здоровыми и активными в течение первых 25 дней, производили кислые метаболиты и имели активные пламенные клетки.

    Метод(ы) in vitro

    T.crassiceps модели in vitro использовались для изучения морфологии почкующихся цистицерков, метаболических путей, метаболизма стероидов у паразита и экспериментального производства ленточных червей. Читатель отсылается к обширному обзору Уиллмса и Зурабяна. 102

    Модели in vitro использовались для оценки эффективности антигельминтных средств против T. crassiceps неполовозрелых стадий. Чтобы определить концентрацию, дающую эффект 50% (EC 50 ), T.crassiceps инкубировали в культуральной среде, содержащей PZQ (0,005–0,04 мкг/мл), альбендазола (ABZ) сульфоксид (0,021–0,16 мкг/мл) или их комбинацию 1:1. 103 Экспериментальную концентрацию (EC 50 ) комбинации определяли по кривой концентрация-реакция, построенной для комбинированного лекарственного лечения. Изменения ультраструктуры ткани паразита были более выражены при применении комбинации PZQ и сульфоксида ABZ. Изоболографический анализ также показал, что вероятно аддитивное взаимодействие между PZQ и сульфоксидом ABZ. Также были исследованы минимальное время воздействия сульфоксида PZQ и ABZ, необходимое для их активности против цист T. solium и T. crassiceps in vitro, а также эффективные концентрации 50% и 99%. 104 Помимо воздействия на ткани паразита, было также исследовано влияние этих активных ингредиентов на энергетический и дыхательный метаболизм T. crassiceps цистицерки, 105 , а также влияние ауранофина на метацестоды (цистицерки) Т .crassiceps в культуре. 106 Было обнаружено, что ауранофин ингибирует тиоредоксин-глутатионредуктазу, причем последняя действует как единственная система контроля окислительно-восстановительного потенциала. Другие антигельминтные средства, протестированные против цист T. crassiceps , представляют собой нитазоксанид, тизоксанид и комбинацию тизоксанид/сульфоксид ABZ. 107 Результаты показали, что нитазоксанид в сочетании с ABZ может быть полезен для лечения цистицеркозных инфекций. Также были проведены метаболические исследования, изучающие альтернативные пути выработки энергии после воздействия антигельминтных средств. 108 Использование аналогов гормонов в защитных целях в качестве терапевтического подхода для предотвращения цистицеркоза мышей также было исследовано in vitro. 109

    Метод(ы) in vivo

    Планирование и проведение испытаний эффективности антигельминтных средств против T. crassiceps должны соответствовать рекомендациям WAAVP по оценке эффективности антигельминтных средств для собак и кошек (см. 41]), хотя эта цестода не рассматривается в руководстве.

    T. crassiceps Модели in vivo использовались для изучения возникновения экспериментальных инфекций у хомяков, бесполого размножения личиночной стадии, метаболизма стероидов у хозяина, продукции ленточных червей in vivo, иммунного ответа и исследований вакцин. Читатель отсылается к обширному обзору Уиллмса и Зурабяна. 102

    Внутрибрюшинная инъекция изолированных клеток T. crassiceps цистицерков различных линий лабораторных мышей представляет собой экспериментальную модель для выявления факторов резистентности у хозяев, для скрининга антицистицерковых препаратов in vitro и для генетических манипуляций с цистицерками. с помощью методов рекомбинантной ДНК. 96

    Также проводились исследования антигельминтной эффективности in vivo. У мышей, инфицированных метацестодами T. crassiceps , следующие соединения были по крайней мере частично эффективны при внутрибрюшинном введении в указанной дозировке: камбендазол (500 мг/кг), мебендазол (6,25 мг/кг), оксибендазол (500 мг/кг). , 5-бензамидо-2(4-тиазолил)бензимидазол (500 мг/кг), 2-карбоэтоксиаминобензимидазол (125 мг/кг) и 2-карбометоксиаминобензимидазол (500 мг/кг). Следующие препараты были неактивны в указанной дозировке: парбендазол (500 мг/кг), тиабендазол (1000 мг/кг) и FBZ (1000 мг/кг).Мебендазол, который показал некоторую активность при дозе 6,25 мг/кг, был высокоактивен при однократном внутрибрюшинном введении при дозе 25 мг/кг. При подкожном введении мебендазол был значительно менее активен, чем при внутрибрюшинном введении. 110 Также была оценена эффективность PZQ против T. crassiceps у мышей, 111 , как и эффективность ABZ. 112 Также было продемонстрировано, что обработка хозяина ABZ и PZQ приводила к окислению жирных кислот и расщеплению аминокислот у T. crassiceps cysticerci. 113 Также было предложено использование гормональных аналогов в защитных целях в качестве терапевтического подхода для предотвращения цистицеркоза мышей. 109

    Защитный иммунный ответ пероральной антирабической вакцины у бездомных собак, корсаков и степных волков после однократной иммунизации

    Вирус и препарат пероральной вакцины

    ) исправленного вируса бешенства. Его получали из тканевого и органного изолята ВВ АЗВИ (Алматинский зооветеринарный институт) [29] путем попеременных и последовательных пассажей на мышах-сосунках и непрерывной культуре клеток ВНК-21 соответственно. Этот штамм вируса (вирус бешенства VRC-RZ2, патент № 17453 от 10 декабря 2004 г. [30]) был рекомендован в качестве основы для пероральной антирабической вакцины [31], поскольку секвенирование гена N показало, что штамм является вакциноподобным и На 99% идентичен российскому штамму РВ-97 (инвентарный номер банка генов: AY705430.1).

    Для приготовления приманок готовили 30% раствор желатинового полимера с дистиллированной водой (Sigma-Aldrich, Сент-Луис, Миссури, США) и выдерживали в течение ночи (18 ч) для набухания полимера. Куриные яйца (Птицефабрика «Аллель-Агро», Казахстан) гомогенизировали, затем добавляли мясокостную муку (Алматинский мясокомбинат, Казахстан).Раствор полимера нагревали до 60°С в течение 20 мин, затем охлаждали до 37°С и переносили в стакан с куриными яйцами и мясокостной мукой, после чего гомогенизировали при 3000 об/мин в течение 10 мин.

    Смесь заливали в специальную форму с блистером, содержащим вакцину, и затем охлаждали при 4°С в течение 1 ч. Полученный осадок вакцины массой 25-30 г имел специфический запах и цвет от светло- до темно-коричневого. Приманка содержала вакцинный вирус РВ в жидком состоянии в дозе 10 6 .75 TCID 50 (объем вакцины 3 мл). Готовая емкость для приманки выглядит как полая параллельная труба размером 5×3×2 см. Таблетка приманки содержит 1 дозу вакцины.

    Животные

    Для исследования использовали сорок две самки бездомных беспородных собак в возрасте 3–12 месяцев (12–15 кг), 15 лисиц-корсаков ( Vulpes corsac ) и 15 степных волков ( Canis lupus campestris ). . Корсаки и волки (не привитые от бешенства) были получены из Алматинского зоопарка. Корсаки и волки содержались поодиночке в специальных клетках.Животных индивидуально идентифицировали с помощью нейлонового ошейника и номерной бирки. Собак до испытания держали на поводке в традиционном вольере для животных в четырех комнатах. Каждая группа находилась в отдельном помещении (т.е. вакцинированные животные были отделены от контроля). Их кормили сухим кормом и дважды в день поили.

    Перед вакцинацией против бешенства и в течение предыдущих 4 недельного карантинного периода они были осмотрены сертифицированным ветеринарным врачом, дегельминтизированы (Alben®) и вакцинированы против чумы плотоядных, аденовироза, парвовироза и парагриппа (Nobivac DHPPI®). Все животные были здоровы и серонегативны по антирабическим ВНА до первой вакцинации.

    Вакцинация и дизайн исследования

    Для изучения безопасности пероральной вакцины (см. Таблицу 1) животных (6 собак, 3 корсака и 3 волка) кормили 10-кратной дозой вакцины на животное (10 приманок). Ежедневное клиническое наблюдение за животными вели в течение 20 сут. На 5-й и 10-й день после приема гранул вакцины у животных брали пробы слюны на выявление РВ.

    Таблица 1 Группы по изучению безопасности

    Для оценки длительности иммунного ответа у животных на РВ использовали 8 собак, 8 корсаков и 8 волков (см. Таблицу 2).Их вакцинировали путем скармливания 1 дозы (приманки) вакцины на животное. У животных брали кровь (10 мл/Becton Dickinson Vacutainer) через 14, 30, 60, 90, 120, 150, 180 и 210 дпв. Образцы крови охлаждали при 4 °C до 48 часов, а затем центрифугировали при 1000×g в течение 12 минут при 4 °C. Сыворотку (2 мл) собирали и замораживали при -20 °C до тестирования. Перед тестированием сыворотку размораживали, а затем инактивировали нагреванием при 56 °C в течение 30 мин.

    Таблица 2 Группы по изучению эффективности

    Для оценки длительности защитного иммунного ответа против РВ-инфекции использовали 16 собак (см. Таблицу 2).Методика вакцинации была такой же, как и при изучении длительности иммунитета. На 14, 90, 180, 180 и 210 дпв животных заражали вирулентным штаммом RV CVS. Для каждой временной точки использовали четырех вакцинированных и двух невакцинированных собак. Собак анестезировали и двусторонне инокулировали 0,5 мл RV (10 5,0 MICLD 50 (50% мышиная внутримозговая летальная доза)) в жевательную мышцу. Всех животных, зараженных вирулентным штаммом CVS, содержали в лабораторных условиях 3 уровня биологической безопасности животных.Животных во всех трех исследуемых группах (группы безопасности, эффективности и контроля) дважды в день осматривали на наличие клинических признаков бешенства (паралич, атаксия, острые изменения поведения, недостаточное потребление пищи, гиперсаливация, вокализация, возбуждение, тремор, судороги, неспровоцированная агрессия) и эвтаназию при появлении двух и более клинических признаков. Все выжившие животные были подвергнуты эвтаназии через 90 дней после заражения (dpc). Исследование с контрольным заражением проводилось только на собаках.

    Это исследование было проведено в соответствии с национальными и международными законами и рекомендациями по обращению с животными.Протокол одобрен Комитетом по этике экспериментов на животных НИИ проблем биологической безопасности Комитета науки МОН РК (номер разрешения: 0514/97).

    Испытание на нейтрализацию вируса на мышах (ВНТ)

    Испытание проводили на мышах массой 8–10 г. Мышам вводили интрацеребрально, используя 0,03 мл инокулята, строго следуя методу, рекомендованному ВОЗ [32]. Их заражали штаммом CVS в дозе 50 MICLD 50 /0.03 мл. Титр антирабических антител рассчитывали по Reed и Muench [33].

    Посмертное исследование

    После эвтаназии или смерти собак у всех животных брали мозг и подчелюстные слюнные железы. Мазки-отпечатки головного мозга и слюнных желез тестировали на наличие антигена РВ методом прямого флуоресцентного теста на антитела (FAT) с использованием флуоресцентного конъюгата, специфичного к нуклеокапсиду РВ (Biorad, Франция, конъюгат 72112) [34].

    Сбор слюны

    Присутствие вируса VRC-RZ2 в слюнных выделениях и образцах крови изучали у животных группы безопасности вакцины (n=12) и контрольной группы (n=6).Образцы слюны были собраны у 18 животных до и на 5 и 10 сутки. Образцы слюны были протестированы на наличие нуклеопротеина рибонуклеиновой кислоты (РНК) бешенства с помощью полимеразной цепной реакции в реальном времени (RT-PCR). Вкратце, вирусную РНК экстрагировали из 150 мкл образцов слюны с использованием мини-набора вирусной РНК QiAmp (Quiagen, Франция) в соответствии с инструкциями производителя.

    Статистический анализ

    Средние геометрические титры ВНА в сыворотке были определены для каждой экспериментальной группы, и ANOVA был использован для измерения значимости наблюдаемых различий.Различия в результатах защиты между экспериментальными группами определяли с помощью точного критерия Фишера. Значения P ≤ 0,05 считались значимыми.

    Филодинамика вируса бешенства в Российской Федерации

    Abstract

    Почти полные последовательности гена N вируса бешенства (1110 нт) были определены для 82 изолятов, полученных из разных регионов России в период с 2008 по 2016 гг. Эти последовательности были проанализированы вместе со 108 репрезентативными последовательностями GenBank за 1977–2016 гг. с использованием байесовского коалесцентного подхода. .Было оценено время основных эволюционных событий. Большинство изолятов представляли вирус степного бешенства группы С, который был обнаружен на обширной географической территории от Центральной России до Монголии и разделен на три группы (С0-С2) с дискретным географическим распространением. На Дальнем Востоке России (Приморский край), вероятно, в результате недавней антропогенной интродукции выделен единственный штамм степной линии вируса бешенства. Впервые полярный вирус бешенства группы А2, ранее зарегистрированный на Аляске, был описан на севере европейской части России и на Земле Франца-Иосифа.Филогенетический анализ показал, что все циркулирующие в настоящее время в Российской Федерации группы вирусов бешенства были занесены в течение нескольких последних столетий, при этом большинство групп распространились в 20 9007-м -м веке. Датировка эволюционных событий хорошо согласовывалась с историческими эпидемиологическими данными.

    Образец цитирования: Девяткин А.А., Лукашев А.Н., Полещук Е.М., Дедков В.Г., Ткачев С.Е., Сидоров Г.Н. (2017) Филодинамика вируса бешенства в Российской Федерации.ПЛОС ОДИН 12(2): e0171855. https://doi.org/10.1371/journal.pone.0171855

    Редактор: Massimo Ciccozzi, Национальный институт здравоохранения, ИТАЛИЯ

    Поступила в редакцию: 23 ноября 2016 г.; Принято: 26 января 2017 г .; Опубликовано: 22 февраля 2017 г.

    Copyright: © 2017 Deviatkin et al. Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные содержатся в документе и в его файлах вспомогательной информации.

    Финансирование: Анализ данных выполнен при поддержке Российского научного фонда (РНФ) грант 14-15-00619 (http://grant.rscf.ru/prjcard_int?14-15-00619).

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    Бешенство является зоонозным вирусным заболеванием, которое при появлении клинических проявлений приводит к летальному исходу.Классический вирус бешенства, RABV, представляет собой вирус одноцепочечной РНК с отрицательным смыслом, относящийся к порядку Mononegavirales , семейству Rhabdoviridae (от латинского rhabdos , что означает «стержень», поскольку представители этого семейства имеют палочковидные вирионы). ), и род Lyssavirus (Лисса, древнегреческая богиня, олицетворение бешенства). Геном RABV состоит из пяти кодирующих белок генов: N, P, M, G и L. Эти гены разделены межгенными областями переменной длины.Ген N обычно используется для филогенетического анализа [1].

    Несмотря на значительный прогресс в борьбе с бешенством во всем мире [2] и успешные программы ликвидации в Западной Европе [3], бешенство остается серьезной проблемой общественного здравоохранения, вызывая более двух миллионов потерянных лет жизни с поправкой на инвалидность (DALY) в год и с ежегодным экономическая стоимость более 4 миллиардов долларов США в год [4]. Большинство случаев бешенства среди людей (примерно 50 000 в год) приходится на Африку и Азию [5]. Предполагается, что официальные статистические данные сильно занижены из-за отсутствия систематического надзора в некоторых странах[6].

    С 2007 по 2011 год в Российской Федерации зарегистрировано 22 264 случая бешенства животных (49,0% диких, 30,0% домашних, 19,9% сельскохозяйственных животных, 1,1% прочих) и 67 случаев бешенства человека. животных и ежегодно получают постэкспозиционную профилактику [7, 8].

    Генетическое разнообразие вируса бешенства во всем мире имеет четкую географическую закономерность, которая является результатом недавнего распространения вируса [9]. Все известные в настоящее время в мире вирусы бешенства можно разделить на семь основных групп [10].Две из этих групп, Cosmopolitan и Arctic/Arctic-like, циркулируют в Российской Федерации. Внутри этих двух основных групп в России зарегистрированы представители шести более мелких групп [11–16]: A. Арктическое бешенство (север Сибири), B. Арктоподобное бешенство (Хабаровский край, Забайкальский край), C. Степное бешенство. (Евразийская степь), D. Среднеевропейское русское бешенство, E. Северо-восточное европейское бешенство и F. Кавказское бешенство.

    Целью данного исследования было изучение филодинамики вируса бешенства в Российской Федерации, чтобы лучше понять закономерности и сроки распространения вируса.

    До этой работы в GenBank были доступны 227 уникальных последовательностей N-гена вируса бешенства из России (согласно описанию последовательности), и только 110 последовательностей были длиннее 400 н. Мы секвенировали 81 штамм из коллекции НИИ природно-очаговых инфекций (Омск, Россия), почти вдвое увеличив количество доступных последовательностей. Еще один изолят получен из национального парка «Русская Арктика» на Землях Франца-Иосифа. Хотя изоляты вируса систематически не собирались по всей стране, набор данных представлял 18 из 85 регионов как европейской, так и азиатской частей России.

    . Материалы и методы. N2-F (ATGACAACTCACARAATGTGTGC)/N2-R(CCTCCATTCATCATGATTCG). Номера доступа приведены в таблице A в файле S1.

    Для филогенетического анализа были использованы все доступные последовательности с известными датами сбора, содержащие положения 100–1209 N-гена.К сожалению, значительное количество последовательностей было непригодно для байесовского коалесцентного филогенетического анализа из-за неизвестной даты сбора. Затем из набора данных были исключены почти идентичные последовательности. В некоторых случаях короткие или не полностью аннотированные последовательности несут важную эпидемиологическую информацию. Филогенетическое положение таких последовательностей оценивали путем реконструкции максимального правдоподобия с использованием программного обеспечения MEGA 6. 0 (S1 Fig). Было обнаружено, что общая обратимая во времени (GTR) модель замещения, включающая долю неизменных участков (I) и гамма-распределение вариаций скорости между участками (G4), лучше всего подходит для данных в соответствии с информационным критерием Акаике.Эти последовательности обсуждаются в тексте при необходимости, но не показаны на рисунках.

    Все доступные нуклеотидные последовательности (по состоянию на 4 июля 2016 г.), содержащие слова «бешенство» и «нуклеопротеин» в поле определения (12 051 последовательность), были загружены из GenBank. Все последовательности короче 1110 нуклеотидов, последовательности без даты выделения и неправильно аннотированные последовательности были удалены. Поскольку в России циркулируют только две основные группы вирусов бешенства, мы выделили всех представителей группы Cosmopolitan (нуклеотидные последовательности, отличающиеся от записи GenBank KC538853 не более чем на 6%) и группы Arctic/Arctic-like (отличающейся от GenBank-подобной группы). запись KY002890 не более чем на 9%).Все последовательности, которые отличались от любой другой последовательности в наборе данных менее чем на 0,1% нуклеотидной последовательности, были исключены. Большинство последовательностей, принадлежавших к группам, не циркулирующим в РФ, также были исключены из дальнейшего анализа. Запись GenBank JQ685915 (летучие мыши Северной Америки RABV) была включена в качестве внешней группы. Последовательности #FJ424484, U43433, U22475, U22840, JF973787, JF973796, KU198463, KU198471, KU198469 и U11375 были добавлены искусственно, чтобы расширить набор данных.

    Множественное выравнивание последовательностей было выполнено с помощью MUSCLE, реализованного в MEGA 6.0 [17]. Номера доступа GenBank для всех изолятов RABV, проанализированных в этом исследовании, представлены в таблице A в файле S1. Окончательный набор данных состоял из 108 последовательностей.

    Выравнивание было проверено на рекомбинацию с использованием программы обнаружения рекомбинации (RDP) версии 4 [18].

    Модель замещения на основе обратимого скачка использовалась для выбора модели замещения и оценки соответствующего количества параметров, а выборка дерева [19] использовалась для байесовского коалесцентного анализа.Затем различные предположения о часах и модели популяции сравнивались с помощью теста байесовских факторов. Самый высокий байесовский фактор наблюдался в комбинации некоррелированных логнормальных расслабленных часов и модели с постоянной популяцией, хотя не было никаких существенных различий между оценками для других комбинаций двух часов (строгие и расслабленные часы) и трех моделей популяций (постоянная, экспоненциальная). и байесовский горизонт). Анализ цепи Маркова методом Монте-Карло был выполнен для 100 миллионов поколений (выборка производится каждые 10 000 поколений).

    Сходимость оценок параметров была проверена с помощью Tracer (v1.5) и отмечена эффективным размером выборки > 200. Деревья максимальной достоверности клады были аннотированы с помощью TreeAnnotator (v2. 4.2) после того, как начальные 10% деревьев были отброшены. Полученное дерево было визуализировано с помощью FigTree (v1.4.2).

    Визуализация распространения вируса бешенства на территории Российской Федерации выполнена с помощью ArcGis (ESRI ArcGis версии 10.4.1). Каждая точка показывает наличие определенной группы вирусов бешенства.Из-за отсутствия точной географической информации точность ограничена административными районами первого уровня.

    Результаты

    Перед филогенетическим анализом набор данных был протестирован на рекомбинацию. Доказательства рекомбинации в последовательности U43432 были обнаружены методом MaxChi [20] и подтверждены филогенетической реконструкцией (данные не представлены). Актуальность этого изолированного открытия трудно интерпретировать. Чтобы не повлиять на филогенетический анализ, последовательность была исключена из набора данных.

    Средняя частота нуклеотидных замен, полученная с использованием набора данных N-гена, составила 2,47*10 -4 [95% наивысшая апостериорная плотность (HPD) = 1,82–3,12*10 -4 ] нуклеотидных замен/сайт/ год. Скорость согласуется с предыдущей оценкой частоты замен N-гена RABV, которая составляла 2,3*10 -4 [95% HPD = 1,1–3,6*10 -4 замен/сайт/год] [9].

    На территории Российской Федерации циркулировали две основные линии вируса бешенства: арктическое/арктоподобное бешенство (группы А и В согласно ранее предложенной классификации [11]) и космополитное бешенство (группы С, D, E и F) (Рисунок 1).

    Рис. 1. Байесовский филогенетический анализ почти полных последовательностей N-генов штаммов вируса бешенства, циркулирующих в Российской Федерации.

    Шкала показывает время в годах. Ветви имеют цветовую маркировку в соответствии с описанными группами. Апостериорные вероятности узлов выше 95% показаны черными квадратами в соответствующих узлах. Апостериорные вероятности между 80–95% обозначены числами. Апостериорные вероятности ниже 80% не указываются. Последовательности, полученные в текущем исследовании, выделены жирным шрифтом.

    https://doi. org/10.1371/journal.pone.0171855.g001

    Филогенетический анализ показал, что самый последний общий предок (MRCA) всех вирусов, циркулирующих в настоящее время в Российской Федерации, существовал в 1670 году [1560–1782].

    Группы C, D, E и F (современные российские космополитические вирусы бешенства) являются потомками предка, существовавшего, скорее всего, около 1849 г. [1796–1894]. Эти группы не были равномерно представлены в нашем наборе данных.

    Группа D включала семь изолятов из центрально-европейского региона России.Эти изоляты имели общего предка в 1969 г. [1950–1986] и были тесно связаны с вирусом, выделенным в Венгрии в 1991 г. MRCA этих вирусов и венгерского изолята датированы 1941 г. [1915–1966]. Следовательно, эта группа, вероятно, была завезена в Россию между 1915 и 1986 гг. (крайние границы интервалов HPD).

    Большинство российских изолятов, которые были секвенированы в этой работе (66/78), и большинство последовательностей GenBank из России в окончательном наборе данных (44/64) принадлежали к группе С. Один вирус, выделенный от кошки в Белгородской области в 1991 г. (AY352456), принадлежал к аутгруппе внутри группы С. Мы предлагаем рассматривать этот штамм как представитель самостоятельной подгруппы вирусов бешенства С0. Остальные вирусы группы С были сгруппированы вместе с апостериорной вероятностью 1,0 и разделены на две подгруппы (С1 и С2). MRCA этих подгрупп существовали примерно в 1948 г. [1929–1964].

    Подгруппа C1 не была надежно подтверждена (апостериорная вероятность 0,55) и может быть альтернативно определена как «все вирусы группы C, не входящие в подгруппы C0 или C2».В него вошли 23 вируса, в основном выделенные к западу от гор Тянь-Шаня и Алтая (рис. 2). Подгруппа C1 может быть подразделена на кластеры C1a и C1b, которые поддерживаются с апостериорной вероятностью 1,0. Кластер С1а был распространен в степных и лесостепных экологических районах европейской части России (Липецкая, Воронежская, Белгородская, Краснодарская, Волгоградская, Брянская, Саратовская области, Республика Дагестан), в Казахстане (Западно-Казахстанская область), и в центральных и восточных областях Украины (S1 рис. ).Представители кластера С1b обнаружены в Омской, Астраханской, Оренбургской, Башкортостанской и Нижегородской областях России, Актюбинской, Алматинской и Восточно-Казахстанской областях Казахстана, Синьцзян-Уйгурском автономном округе Китая.

    Рис. 2. Распространение генотипов вируса бешенства в Российской Федерации и сопредельных странах.

    Указано географическое распространение филогенетических групп вируса бешенства. Точность ограничена административными районами первого уровня.

    https://doi.org/10.1371/journal.pone.0171855.g002

    Подгруппа С2 (апостериорная вероятность 1,0) включала 38 штаммов, преимущественно выделенных восточнее линии Астана-Ташкент. Было частичное перекрытие в распределении подгрупп С1 и С2 (рис. 2). Подгруппа C2 разделена на три географически обособленных кластера. Первый кластер (С2с) обнаружен в Омской области (Россия) и Алматинской области (Казахстан), а второй (С2а) циркулировал на территории Южной Сибири (Бурятия, Хакасия, Республика Тыва, Омск и Красноярск). области), Казахстан (Алматинская область), Китай (район Внутренняя Монголия) и Монголия (Завханская, Гови-Алтайская и Хубсугульская области).Кластер С2b преобладал в России (Алтайский край и Омская область), Монголии (Хубсугульская область) и Казахстане (Алматинская и Восточно-Казахстанская области) (рис. 1, 2). Поддержка апостериорной вероятности для кластеров C2a, C2b и C2c составила 0,83, 0,91 и 1,0 соответственно.

    В группу Е вошли три вируса из северо-западной части России, которые были близкородственными вирусу, выделенному в Эстонии в 1991 г. В целом группа Е соответствует ранее описанной группе Северо-Восточной Европы [21].МРКА российских представителей группы Северо-Восточной Европы существовал примерно с 1974 г. [1962–1983 гг.]. MRCA этих вирусов и эстонский изолят существовали в 1920 г. [1889–1950].

    Группа E (Северо-Восточная Европа) была тесно связана с группами Западной, Восточной и Центральной Европы. MRCA групп Северо-Восточной, Западной, Восточной и Центральной Европы существовали около 1889 г. [1858–1924].

    Группа F (кавказское бешенство) включала два вируса из Краснодарского края и Дагестана.Эти вирусы, по-видимому, произошли от общего предка, существовавшего примерно в 1992 г. [1979–2004 гг.]. Другие представители этой группы были обнаружены на Ближнем Востоке (Ирак, Иран и Турция). Ранее иранский штамм был описан как принадлежащий к филогруппе вируса бешенства Иран-1а [22]. MRCA группы F существовали около 1966 г. [1947–1983].

    Группы А (арктическое бешенство) и В (арктическое бешенство) разошлись примерно в 1806 г. [1732–1871]. Арктическая группа бешенства А ранее подразделялась на четыре подгруппы: Арктика-1 (А1), Арктика-2 (А2), Арктика-3 (А3) и Арктика-4 (А4).Arctic-1 состоит из штаммов, циркулирующих только в провинции Онтарио, Канада. Представители подгруппы Арктика-4 обнаружены только в американском штате Аляска. Подгруппы Арктика-2 и Арктика-3 распространены на нескольких обширных территориях: север Якутии, Аляска (А2), север Красноярского края, Канада, Гренландия (А3) [23–25]. По нашим данным, подгруппа А2 возникла в 1979 г. [95% HPD 1973–1985 гг.], а подгруппа А3 – в 1971 г. [1962–1979 гг.]. МРКА подгрупп А2 и А3 возникли примерно в 1960 г. [1946–1972].Эти результаты согласуются с предыдущими оценками с использованием N-гена [24]. Однако в другом исследовании [23] все временные рамки были оценены как значительно более ранние. Причина такого несоответствия неясна.

    Интересно, что некоторые представители подгруппы А2 (EF611834, EF611837, EF611840, EF611836, EF611832, EF611835, EF611839, EF611838) [23] были выделены в Якутии в 1950–1960 гг. исключаются из байесовского анализа).Предполагаемое появление текущей подгруппы А2 кажется правильным, поскольку современные штаммы вируса бешенства, по-видимому, не являются потомками этой группы, как это представлено этими архивными изолятами (данные не показаны). По-видимому, якутская группа вымерла, в соответствии с MRCA современных представителей подгруппы А2 в 1979 г. (95% HPD 1973–1985).

    В настоящей работе представители подгруппы Арктика-2 обнаружены в северной части европейского региона России (Ненецкий автономный округ, Республика Коми) и на Земле Франца-Иосифа. Ранее случаев бешенства на Земле Франца-Иосифа не регистрировали. В 2016 году при мониторинге павших животных на природном курорте Земля Франца-Иосифа была обнаружена туша песца ( Vulpes lagopus ) в неестественной позе. Заражение бешенством было подтверждено методом ПЦР с обратной транскриптазой. Впоследствии штамм вируса был выделен из ткани головного мозга и полностью секвенирован (за исключением 5’- и 3’-концов). Последовательность генома была депонирована в GenBank (инвентарный номер KX954123).

    Обсуждение

    Основной целью данного исследования было дать всестороннее представление о циркуляции вируса бешенства в Российской Федерации. Для выяснения филогенетического родства между различными вирусными группами мы использовали 64 последовательности из 21 из 85 административных регионов как европейской, так и азиатской частей России и 45 последовательностей из 16 соседних стран, которые охватывают временной интервал с 1977 по 2016 год.

    Степное бешенство группы С было самым распространенным в Российской Федерации. Он циркулирует в степных и лесостепных экологических районах Евразии, а его основными резервуарами являются лисицы ( Vulpes vulpes и Vulpes corsac ). В нашей выборке группу С составил 61 вирус, которые были выделены на большой территории и за последние 70 лет дивергировали от MRCA, существовавшего примерно в 1948 г. В первой половине ХХ века бешенство регистрировали преимущественно у волков. , кошки и собаки. Первые случаи бешенства в Астраханской области (Юг России) зарегистрированы в 1942 г. у енотовидной собаки ( Nyctereutes procyonoides ).Затем последовала вспышка бешенства среди лисиц в Астраханской области в 1946 г. [26]. Это были первые задокументированные случаи бешенства у лисиц в СССР [27]. По историческим статистическим данным некоторые авторы предполагали, что быстрая экспансия степной группы бешенства началась в Астраханской области, а затем распространилась на другие территории со сходными экологическими условиями со средней скоростью 40–60 км/год [28]. В 1949 году в Казахстане было зарегистрировано бешенство лисиц. В Южной Сибири (Новосибирск) первые вспышки бешенства лисиц произошли в 1958 г.[11].Эта историческая картина распространения бешенства и гипотеза о подгруппах C1/C2, возникших в начале 1940-х годов, были подтверждены результатами байесовского коалесцентного филогенетического временного анализа. По оценкам, MRCA подгрупп степного бешенства C1/C2 существовала в 1948 г. [1929–1964]. Кроме того, исторические данные о появлении бешенства в Новосибирске в 1958 г. укладываются во временные рамки вероятной МРКА подгруппы С2 в 1956 г. [1941–1970]. В эту подгруппу входят вирусы, выделенные в Омской и Красноярской областях, граничащих с Новосибирской областью с запада и востока соответственно.

    Практически мгновенное распространение степной группы бешенства на просторах евразийской степи и лесостепи произошло примерно в 1940-х и 1950-х годах и могло отражать так называемую эволюционную модель «Большого биологического взрыва» в малом масштабе [29,30]. Эта гипотеза предполагает, что в эволюционном процессе существуют две качественно различные фазы: инфляционная фаза (создаются новые разнообразные группы) и фаза медленной эволюции. В 1940-х и 1950-х годах по социально-экономическим причинам происходила интенсивная миграция населения на территории бывшего СССР.Вероятно, животные-носители предка вируса степного бешенства также транспортировались и контактировали с восприимчивой и наивной местной популяцией животных. Внедрение возбудителя в новую экологическую нишу (переход хозяина в популяцию лисиц) может привести к быстрому распространению и диверсификации вируса на новых территориях (инфляционная фаза эволюции, ведущая к созданию географически дискретных мутантных сетей). Поскольку бешенство хорошо известно во всех странах мира, вполне возможно, что подобное распространение популяции вируса имело место и раньше, но не оставило следов в связи с последующим исчезновением большинства вариантов вируса.

    Важность гипотетических антропогенных факторов в молекулярной эволюции бешенства подчеркивается выделением степного кластера С1а на Дальнем Востоке России. Ранее на юге Дальнего Востока России отмечалась циркуляция только арктоподобных штаммов вируса бешенства (группа В) [11]. Нападение бурого медведя ( Ursus arctos ) было зарегистрировано в ноябре 2014 г. в Хасанском районе Приморского края (у побережья Тихого океана). Девиантное поведение медведя привело к подозрению на бешенство животного.Заболевание было подтверждено несколькими методами [31,32], вирус был выделен и секвенирован (номер доступа KP997032). Поразительно, что этот штамм принадлежал к кластеру западностепного бешенства С1а. Наиболее генетически родственные штаммы выделены в степных районах европейской части России (Липецкая и Воронежская области) и в Западно-Казахстанской административной области (рис. 1). Например, изолят дальневосточного медведя КП997032 и изолят КТ965737 2014 года в Западно-Казахстанской области делят 99.67% идентичность нуклеотидной последовательности во фрагменте N-гена длиной 1228 нуклеотидов. MRCA этих двух вирусов существовали в 2004 г. [1997–2012 гг.]. Расстояние между Приморским краем и Уралом (столицей Западно-Казахстанской области) составляет 5800 км. Другие дивергентные представители группы С циркулировали в Южной Сибири, Казахстане, Монголии и северо-западных провинциях Китая (рис. 2). Таким образом, антропогенный перенос вируса, произошедший менее 20 лет назад, является наиболее вероятным механизмом появления вируса бешенства группы С на юге Дальнего Востока России.

    Сообщается, что в Европе эволюция вируса бешенства претерпела две исторические смены хозяина [21]. Первый произошел, когда вирус перешел от собак к лисам, гипотетически в первые десятилетия 20-го века [33]. Это предполагаемое событие соответствует общему предку групп WE, EE, CE и E (Западная, Восточная, Центральная и Северо-Восточная Европа соответственно) на рис. 1. Предполагаемый MRCA этих широко распространенных в Европе подгрупп вирусов бешенства существовал около 1889 г. 1924], что согласуется с эпидемиологической гипотезой.Миграция бешеных лисиц на запад от бывшей советско-польской границы регистрируется с 1939 г. Согласно анализу молекулярных часов, MRCA штаммов вируса бешенства, выделенных в Польше и Германии (подгруппа Центральная Европа), Франции и Италии (подгруппа Западная Европа ) существовал примерно в 1939 г. [1919–1958 гг.], что также соответствует натурным наблюдениям [34].

    Вторая смена хозяина произошла в Северо-Восточной Европе, когда вирус бешенства колонизировал енотовидных собак.В период с 1928 по 1957 г. около 9100 животных было интродуцировано из Восточной Азии в более чем 70 районов бывшего СССР в попытке обогатить фауну промысловым пушным зверьком [35]. Енотовидные собаки успешно заселили западные районы бывшего СССР. Сегодня этот чужеродный вид заселил большую часть Европы (от России на востоке до Германии на западе, от Финляндии на севере до Словакии и Молдавии на юге). Вирус бешенства группы Е (ВЭЭ по другой классификации [11]) сохраняется в двух основных резервуарах дикой природы: лисицах и енотовидных собаках.По нашим оценкам, МРКА группы Е существовал около 1920 г. [1889–1950]. Ранее было неясно, были ли источником вируса у енотовидных собак инфицированные лисы или вирус, который попал к енотовидным собакам непосредственно от собак, а затем передался популяции лисиц [21]. Согласно молекулярному анализу, предковая вирусная популяция современных вирусов группы Е могла существовать в Европе до появления енотовидных собак; однако широкий интервал HPD в этом узле не позволяет дать окончательный ответ.

    кавказского бешенства (группа F) относились к ранее описанной группе Иран-1а [22]. Именно группа собачьего бешенства была распространена в ближневосточном регионе (Ирак, Иран, Турция). Первые российские представители этой группы были выделены в 2005 г. [12]. Кроме того, самые глубокие ответвления внутри группы F обнаружены на Ближнем Востоке. Поэтому можно предположить, что эта группа вирусов не циркулировала в России до 1979 г. (нижняя крайняя граница интервала HPD для MRCA российских представителей группы F) и, вероятно, была занесена в Россию совсем недавно из приграничных кавказских государств.Между тем случаи бешенства в кавказских регионах РФ были выявлены гораздо раньше, хотя последовательности этих вирусов отсутствуют. В результате всесторонняя история группы F на территории России остается неизвестной.

    Подгруппы арктического бешенства А2 и А3 распространены на обширных циркумполярных территориях, но их генетическое разнообразие крайне низкое по сравнению с вирусами других групп. Например, N-ген KX954123 (выделен на Земле Франца-Иосифа, Россия, в 2016 г.) имеет 99 долей.3% идентичных нуклеотидов с N-геном JN258592 (выделено на Аляске в 2008 г.). Все штаммы подгрупп А2 и А3 имели 97,39–100,00% идентичности последовательностей. Столь низкое разнообразие можно объяснить быстрым распространением вируса из-за дальней миграции полярных хищников. Действительно, в марте площадь арктических льдов максимальна, и все приполярные территории (Аляска, Северная Канада, Гренландия и Север России) представляют собой единый экологический регион (S2 рис.) со сходными природными условиями. Основным хозяином арктического бешенства является песец ( Vulpes lagopus ), который в холодное время года способен мигрировать более чем на 5000 км [36].Здесь мы описали вирус, который был обнаружен на Земле Франца-Иосифа и был наиболее похож на аляскинские, но не на северо-сибирские изоляты, что еще раз иллюстрирует высокую скорость пространственного распространения полярного бешенства.

    Бешенство передается в основном при прямом физическом контакте. Поэтому для эффективной передачи требуется достаточная плотность популяции животных [34]. Плотность популяции животных постоянно колеблется в связи с изменением условий окружающей среды, что может привести к исчезновению филогенетических групп вируса бешенства.Однако после того, как плотность хозяев снижается ниже критического уровня и вирус вымирает, популяции животных обычно восстанавливаются и становятся восприимчивыми к быстрому распространению вируса. Наш анализ поддерживает эту модель, которая подразумевает циклы расширения и исчезновения вирусной популяции и имеет важные практические последствия. Существует два возможных способа ликвидации вируса бешенства. Это может быть достигнуто либо путем уменьшения плотности основных хозяев путем частичного истребления популяции животных, либо путем уменьшения плотности основных восприимчивых хозяев путем оральной вакцинации популяции животных.Попытки контролировать распространение бешенства в Европе путем сокращения популяции хозяев оказались неэффективными [34]. Однако внедрение программ пероральной вакцинации против бешенства (ОРВ) в странах Западной Европы (S3 Fig) оказалось наиболее эффективным методом элиминации бешенства [37]. Предыдущие безуспешные попытки поставили под сомнение возможность эрадикации бешенства в России с помощью ОРВ [38], хотя эту неудачу можно объяснить плохой организацией [39].

    Филогенетический анализ свидетельствует об относительно недавнем появлении всех групп вирусов бешенства, циркулирующих в настоящее время на территории Российской Федерации.Между тем бешенство в России было известно гораздо раньше [40]. Таким образом, древние варианты вируса вымерли по естественным причинам, и популяция вируса не была стабильной в долгосрочной перспективе. Этот вывод подразумевает, что давление на популяцию вируса, оказываемое пероральной вакцинацией диких плотоядных, может привести к исчезновению вируса. Однако необходимы дальнейшие полевые исследования для разработки эффективной общенациональной стратегии ликвидации бешенства. В то же время некоторые резервуары вируса бешенства, например летучие мыши, не могут быть вовлечены в программы вакцинации [41].Поэтому даже в случае элиминации RABV плотоядных глобальная ликвидация бешенства и бешенствоподобных вирусов не представляется осуществимой из-за вероятности межвидового распространения инфекции [42].

    Заключение

    Программа ликвидации бешенства была успешной в Западной Европе, однако бешенство остается эндемичным в России. Анализ показывает, что определенные группы вирусов циркулируют в различных экологических регионах. Популяция вируса на удивление проста и предполагает прямолинейный характер распространения, который, по-видимому, имел место в течение последних нескольких столетий при отсутствии долгосрочной эндемичности вируса.Было очевидно лишь несколько заносов вируса из соседних стран. Такая схема предполагает, что ликвидация бешенства на большей части территории России возможна.

    Благодарности

    Авторы благодарят Гаврило М.В. из национального парка «Русская Арктика», г. Архангельск, Российская Федерация, за предоставление образцов песца.

    Вклад авторов

    1. Концептуализация: AAD ANL EMP VGD GAS.
    2. Формальный анализ: AAD ANL EMP GGK.
    3. Расследование: AAD ANL EMP SET GNS VGD.
    4. Ресурсы: EMP GNS GGK SET IVG MYS GAS.
    5. Письмо – первоначальный проект: AAD ANL.
    6. Написание – проверка и редактирование: AAD ANL EMP GGK.

    Каталожные номера

    1. 1. Сайто М., Ошитани Х., Орбина JRC, Тома К., де Гусман А.С., Камигаки Т. и др. Генетическое разнообразие и географическое распространение генетически различных вирусов бешенства на Филиппинах.PLoS Negl Trop Dis. 2013;7: e2144. пмид:23593515
    2. 2. Дицшольд Б., Фабер М., Шнелл М.Дж. Новые подходы к профилактике и ликвидации бешенства. Эксперт Rev Вакцины. 2003;2: 399–406. пмид:125
    3. 3. Rupprecht CE, Barrett J, Briggs D, Cliquet F, Fooks AR, Lumlertdacha B, et al. Можно ли искоренить бешенство? Дев Биол Базель. 2008; 131: 95–122. пмид:18634470
    4. 4. Фукс А.Р., Бэнъярд А.С., Хортон Д.Л., Джонсон Н., МакЭлхинни Л.М., Джексон А.С.Текущее состояние бешенства и перспективы ликвидации. Ланцет. ООО «Эльзевир»; 2014; 6736: 1–11.
    5. 5. Кнобель Д.Л., Кливленд С., Коулман П.Г., Февр Э.М., Мельцер М.И., Миранда М. и соавт. Переоценка бремени бешенства в Африке и Азии. Всемирный орган здравоохранения Быка. 2005; 83: 360–366. пмид:15976877
    6. 6. Кливленд С., Февр Э.М., Кааре М., Коулман П.Г. Оценка смертности людей от бешенства в Объединенной Республике Танзания в результате укусов собак. Всемирный орган здравоохранения Быка.2002; 80: 304–10. Доступно: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2567765&tool=pmcentrez&rendertype=abstract pmid:12075367
    7. 7. Полещук Е.М., Сидоров Г.Н., Березина Е.С. Бешенство животных в России в 2007–2011 гг. Русь Вет Журнал Малый Дом дикой Аним. 2012;6: 8–12.
    8. 8. Львов Д.К., Щелканов М.Ю., Альховский С.В., Дерябин П.Г. Фронт-материя. Зоонозные вирусы Северной Евразии. Эльзевир; 2015.
    9. 9. Bourhy H, Reynes J-M, Dunham EJ, Dacheux L, Larrous F, Huong VTQ и др.Происхождение и филогеография вируса собачьего бешенства. Джей Ген Вирол. 2008; 89: 2673–81. пмид:18931062
    10. 10. Джексон АС. Бешенство: научные основы болезни и борьбы с ней. Третье редактирование. Джексон AC, редактор. Сан-Диего: Эльзевир; 2013.
    11. 11. Кузьмин И.В., Ботвинкин А.Д., МакЭлхинни Л.М., Смит Дж.С., Орсиари Л.А., Хьюз Г.Дж. и соавт. Молекулярная эпидемиология наземного бешенства в бывшем Советском Союзе. Дж. Уайлдл Дис. 2004; 40: 617–631. пмид:15650080
    12. 12.Метлин А., Рыбаков С., Груздев К., Нойвонен Э., Хуовилайнен А. Генетическая гетерогенность российских, эстонских и финских полевых вирусов бешенства. Арх Вирол. 2007; 152: 1645–54. пмид:17558542
    13. 13. Полещук Е.М., Сидоров Г.Н., Грибенча СВ. Обобщение данных об антигенном и генетическом разнообразии вируса бешенства, циркулирующего у наземных млекопитающих России. Вопр Вирусол. 2013;3: 9–16.
    14. 14. Полещук Е.М., Сидоров Г.Н., Ткачев С.Е., Девяткин А.А., Дедков В.Г., Очкасова Ю.В., и соавт.Эколого-вирусологические особенности эпизоотического процесса бешенства в центрально-черноземном регионе России. Вет Патол. 2013;2: 101–108.
    15. 15. Полещук Е.М., Сидоров Г.Н., Ткачев С.Е. Молекулярная эпидемиология бешенства на юге Восточной Сибири. Расс Дж. Заражает Иммун. 2013;3: 164–164.
    16. 16. Чупин С.А., Чернышова Е.В., Метлин А.Е. Генетическая характеристика полевых изолятов вируса бешенства, выявленных в Российской Федерации в период 2008–2011 гг.Вопр Вирусол. 2013; 58: 44–48.
    17. 17. Тамура К., Стечер Г., Петерсон Д., Филипски А., Кумар С. MEGA6: Молекулярно-эволюционный генетический анализ, версия 6.0. Мол Биол Эвол. 2013; 30: 2725–2729. пмид:24132122
    18. 18. Мартин Д.П., Мюррелл Б., Голден М., Хусал А., Мухир Б. RDP4: Обнаружение и анализ моделей рекомбинации в геномах вирусов. Вирус Эвол. 2015;1: 1–5.
    19. 19. Bouckaert R, Heled J, Kuhnert D, Vaughan T, Wu CH, Xie D, et al.BEAST 2: Программная платформа для байесовского эволюционного анализа. PLoS Comput Biol. 2014; 10: 1–6.
    20. 20. Смит Дж.М. Анализ мозаичной структуры генов. Дж Мол Эвол. 1992; 34: 126–129. пмид:1556748
    21. 21. Бури Х., Кисси Б., Одри Л., Смречак М., Садковска-Тодис М., Кулонен К. и др. Экология и эволюция вируса бешенства в Европе. Джей Ген Вирол. 1999; 80 (Pt 10: 2545–57. Доступно: http://www.ncbi.nlm.nih.gov/pubmed/10573146
    22. 22. Надин-Дэвис С., Симани С., Армстронг Дж., Фаяз А., Ванделер А.Молекулярная и антигенная характеристика вирусов бешенства из Ирана выявляет варианты с различным эпидемиологическим происхождением. Эпидемиол инфекции. 2003; 131: 777–790. пмид:12948379
    23. 23. Кузьмин И.В., Хьюз Г.Дж., Ботвинкин А., Грибенча С.Г., Рупрехт С.Е. Арктические и арктоподобные вирусы бешенства: распространение, филогения и история эволюции. Эпидемиол инфекции. 2008; 136: 509–19. пмид:17599781
    24. 24. Надин-Дэвис Са, Шин М., Ванделер А.И. Недавнее появление арктической линии вируса бешенства.Вирус рез. 2012; 163: 352–62. пмид:22100340
    25. 25. Hanke D, Freuling CM, Fischer S, Hueffer K, Hundertmark K, Nadin-Davis S, et al. Пространственно-временной анализ генетического разнообразия арктических вирусов бешенства и их резервуарных хозяев в Гренландии. Рекуенко С., редактор. PLoS Negl Trop Dis. 2016;10: e0004779. пмид:27459154
    26. 26. Сидоров Г., Сидорова Д., Полещук Е. Бешенство диких млекопитающих в России с конца XIX до начала ХХ века.Расс Джей Зул. 2010; 88: 26–36.
    27. 27. Березина Е.С., Сидоров Г.Н., Полещук Е.М., Сидорова Д.Г. Мелкие дикие псовые и их роль в заболеваемости человека бешенством в России. Русь Вет Журнал Малый Дом дикой Аним. 2011;2: 26–29.
    28. 28. Сидоров ГН. Аспекты исторического развития природных очагов бешенства в Европе и Северной Азии. Вет Патол. 2002; 1: 21–25.
    29. 29. Кунин Е. В. Биологическая модель Большого взрыва для основных переходов в эволюции.Биол Директ. 2007;2: 21. pmid:17708768
    30. 30. Кунин Е.В., Вольф Ю.И., Нагасаки К., Доля В.В. Большой взрыв эволюции пикорноподобных вирусов предшествует излучению эукариотических супергрупп. Nat Rev Microbiol. 2008; 6: 925–939. пмид:18997823
    31. 31. Щелканов М.Ю., Девяткин А.А., Ананьев В.Ю., Дедков В.Г., Шипулин Г.А., Сокол Н.Н., и соавт. Полная последовательность генома штамма вируса бешенства, выделенного от бурого медведя (Ursus arctos) в Приморском крае, Россия (ноябрь 2014 г.).Объявление генома. 2016;4: e00642–16.
    32. 32. Щелканов М.Ю., Девяткин А.А., Ананьев В.Ю., Фролов Е.В., Домбровская И.Е., Дедков В.Г., и соавт. Выделение и полногеномное секвенирование штамма вируса бешенства, выделенного от бурого медведя (Ursus arctos), напавшего на человека в Приморском крае (ноябрь 2014 г.). Вопр Вирусол. 2016; 61: 180–186.
    33. 33. McElhinney LM, Marston DA, Freuling CM, Cragg W, Stankov S, Lalosević D, et al. Молекулярное разнообразие и эволюционная история штаммов вируса бешенства, циркулирующих на Балканах.Джей Ген Вирол. 2011; 92: 2171–80. пмид:21632560
    34. 34. Андерсон Р.М., Джексон Х.К., Мэй Р.М., Смит А.М. Динамика популяции лисьего бешенства в Европе. Природа. 1981; 289: 765–771. пмид:7464941
    35. 35. Малдер Дж.Л. Обзор экологии енотовидной собаки (Nyctereutes procyonoides) в Европе. Лутра. 2012; 55: 101–127.
    36. 36. Гамильтон Г. Полярные кочевники: лисы-призраки Арктики. Новый ученый. 2011. Доступно: https://www.newscientist.com/article/mg20927981-700-polar-nomads-ghost-foxes-of-the-arctic/
    37. 37.Витасек Дж. Обзор элиминации бешенства в Европе. Vet Med — Чехия. 2004; 2004: 171–185.
    38. 38. Авилов В.М., Сочнёв В.В., Резябкин И.Н., Алиев А.А., Саввин А.В., Горячев И.И. Иммунизация диких плотоядных животных вакцинацией против бешенства в районах высокого риска. Вет Патол. 2004;3: 134–138.
    39. 39. Макаров ВВ. Пероральная вакцинация лисиц от бешенства безальтернативна. Вет Патол. 2009; 4: 2–5.
    40. 40. Ботвинкин А, Косенко М.Бешенство в европейской части России, Беларуси и Украины. В: Кинг А.А., Фукс А.Р., Обер М., Ванделер А.И., редакторы. Историческая перспектива бешенства в Европе и Средиземноморском бассейне. Париж; 2004. С. 47–65. https://doi.org/10.1016/j.trstmh.2005.04.006
    41. 41. Рупрехт К.Э., Кузьмин И.В. Почему мы можем предотвратить, контролировать и, возможно, лечить — но не искоренить — бешенство. Будущий Вирол. 2015; 10: 517–535.
    42. 42. Бадран Х., Тордо Н. Переключение хозяина в истории лиссавирусов с отрядов рукокрылых на отряды плотоядных.Дж Вирол. 2001; 75: 8096–8104. пмид:11483755

    Corsac Fox media — Энциклопедия жизни

    Картина XIX века с изображением корсака ( Vulpes corsac ) взять с сайта pre1900prints.com Public domainPublic domainfalsefalse Это произведение является общественным достоянием в стране его происхождения и других странах и территориях, где срок действия авторского права составляет жизнь автора плюс 70 лет или менее . Вы также должны включить тег общественного достояния США, чтобы указать, почему эта работа является общественным достоянием в США.Обратите внимание, что в некоторых странах срок действия авторского права превышает 70 лет: в Мексике — 100 лет, на Ямайке — 95 лет, в Колумбии — 80 лет, а в Гватемале и Самоа — 75 лет. Это изображение может быть , а не общественным достоянием в этих странах, которые, кроме того, не реализуют правило более короткого срока. В Кот-д’Ивуаре общий срок авторского права составляет 99 лет, а в Гондурасе — 75 лет, но они применяют правило более короткого срока. Авторские права могут распространяться на произведения, созданные французами, погибшими за Францию ​​во Второй мировой войне (подробнее), русскими, проходившими службу на Восточном фронте Второй мировой войны (известной в России как Великая Отечественная война) и посмертно реабилитированными жертвами советских репрессий ( больше информации).Этот файл был идентифицирован как свободный от известных ограничений в соответствии с законом об авторском праве, включая все смежные и смежные права. Разрешается копировать, распространять и/или изменять этот документ в соответствии с условиями лицензии GNU Free Documentation License версии 1.2 или любой более поздней версии, опубликованной Free Software Foundation; без неизменяемых разделов, без текстов на передней и задней обложках. Копия лицензии включена в раздел GNU Free Documentation License .http://www.gnu.org/copyleft/fdl.htmlGFDLGNU Free Documentation Licensetruetrue Этот файл находится под лицензией Creative Commons Attribution-Share Alike 3.0 Unported. Этот тег лицензирования был добавлен в этот файл как часть обновления лицензирования GFDL.

    ПРАЙМ PubMed | Бешенство в монгольских степях

    Цитирование

    Ботвинкин А.Д. и соавт. «Бешенство в монгольских степях. Developments in Biologicals, vol. 131, 2008, pp. 199-205.

    Botvinkin AD, Otgonbaatar D, Tsoodol S, et al. Бешенство в монгольских степях. Dev Biol (Basel) . 2008;131 :199-205.

    Ботвинкин А.Д., Отгонбаатар Д., Цоодол С., Кузьмин И.В. (2008 г.) Бешенство в монгольских степях Развитие биологических препаратов , 131 , 199-205.

    Ботвинкин А. Д. и др. Бешенство в монгольских степях Dev Biol (Базель). 2008;131:199-205. PubMed PMID: 18634480.

    TY — JOUR Т1 — Бешенство в монгольских степях. AU — Ботвинкин А Д, AU — Отгонбаатар,Д, AU — Цоодол,С, АУ — Кузьмин И В, PY – 19 июля 2008 г./опубликовано PY — 2/10/2008/medline PY – 19 июля 2008 г. СП — 199 ЭП-205 JF — Разработки в области биологических препаратов JO — Дев Биол (Базель) ВЛ — 131 N2 — Исторически бешенство в Монголии было связано со специфическими степными и лесостепными ландшафтами, известными как монгольские степи.Основными резервуарами вируса бешенства (RABV) являются волк, рыжая лисица и корсак. Бешенство лисиц было зарегистрировано в Монголии с начала 1960-х годов. С 1994 по 2004 год в Монголии было зарегистрировано одиннадцать случаев бешенства среди людей (0,4 на миллион жителей). В качестве источников заражения человека преобладали дикие животные: пять человек погибли от укусов волков, двое от лисиц и четверо от собак. С 1996 по 2004 год было зарегистрировано 1273 случая бешенства у животных (около 140 в год). Крупный рогатый скот составил более 80% всех зарегистрированных случаев.Монгольские степи продолжаются в Читинскую область России и республики Бурятия, Тыва и Алтай. Четыре изолята RABV из западной части Монголии секвенировали и сравнивали с имеющимися изолятами из России, Китая и других стран. Изоляты из Монголии относились к «степной» филогенетической кладе, включающей вирусы, циркулирующие на обширных территориях, от Юго-Восточной Европы до Тывы, Западной Сибири и Казахстана. Однако изоляты RABV из степей монгольского типа на востоке (Читинская область, Россия) относятся к восточной группе арктоподобных вирусов.СН — 1424-6074 УР — https://www.unboundmedicine.com/medline/citation/18634480/rabies_in_the_mongolian_steppes_ L2 — http://www.diseaseinfosearch.org/result/6131 ДБ — ПРАЙМ ДП — Свободная медицина Скорая помощь —

    МОЛЕКУЛЯРНАЯ ЭПИДЕМИОЛОГИЯ НАЗЕМНОГО БЕШЕНСТВА В БЫВШЕМ СОВЕТСКОМ СОЮЗЕ

    Пятьдесят пять изолятов вируса бешенства, происходящих из различных регионов бывшего Советского Союза (БСС), сравнивали с изолятами, происходящими из Евразии, Африки и Северной Америки, по полным или частичным последовательностям генов нуклеопротеинов (N).Изоляты бывшего СССР сформировали пять отдельных групп. В группу А вошли вирусы арктического происхождения, сходные с вирусами Аляски и Канады. Группу Б составили «арктоподобные» вирусы, происходящие с юга Восточной Сибири и Дальнего Востока. Группу С составили вирусы, циркулирующие на степных и лесостепных территориях от европейской части России до Тувы и Казахстана. Эти три филогенетические группы явно отличались от европейского кластера. Вирусы группы D циркулируют вблизи западной границы России.Их филогенетическое положение занимает промежуточное положение между группой С и европейским кластером. Группа Е состояла из вирусов, происходящих из северо-западной части России, и включала описанную ранее группу «северо-восточная Европа» из Балтийского региона. По данным надзора, конкретный хозяин может быть четко определен только для группы А (песец; Alopex lagopus ) и для дальневосточной части ареала группы Б (енотовидная собака; Nyctereutes procyonoides ). Для других территорий и вариантов вируса бешенства основным резервуаром вируса является рыжая лисица ( Vulpes vulpes ).Однако степная лисица ( Vulpes corsac ), волк ( Canis lupus ) и енотовидная собака также участвуют в циркуляции вируса, в зависимости от плотности популяции хозяина.

    Добавить комментарий

    Ваш адрес email не будет опубликован.