Чем лечить лямблии: Лямблиоз у детей — причины, симптомы, диагностика и лечение лямблиоза у детей в Москве в детской клинике «СМ-Доктор»

Содержание

лечение народными средствами и в домашних условиях

Содержание

Лямблиоз представляет собой очень распространенное заболевание, которое поражает тонкий кишечник. Сложность в том, что при длительном отсутствии лечения происходит нарушение системы пищеварения. Кроме того, в некоторых случаях человек может быть носителем заболевания, но у него самого воспалительный процесс так и не начинается.

Эффективным лечением против лямблии является использование народных средств — трав и растений. Кроме того, данный метод более безопасный и выгодный. Но вместе с этим рекомендовано обратиться к доктору и пройти обследование, контролировать состояние здоровья и провести консультацию по поводу оптимального лечения.

Что такое лямблия, какие симптомы заболевания?

Лямблия – микроскопический одноклеточный жгутиковый паразит из класса простейших. Размножается цистами, внутреннее строение защищает прочная оболочка.

Источниками заражения могут служить грунт, водоемы, домашние животные, реже – растения. Особенно уязвимы в этом отношении дети, традиционно пренебрегающие принципами санитарной безопасности. Интенсивное развитие паразитов происходит в благоприятной среде кишечника с пониженным уровнем кислотности. Особенность лямблиоза в том, что протекает он с клиническими проявлениями либо бессимптомно.

Можно выделить следующие свойства патологии:

  • Кишечные. Дискинезия 12-перстной кишки и энтерит. Дискомфорт в пупочной зоне, вздутие, раздражение кожи, налет во рту.
  • Гепатобилиарные. Холецистит, дискинезия желчевыводящих путей. Зуд, горечь в полости рта, боль в правом подреберье.
  • Астено-невротические. Бессонница, головная боль, утомляемость.
  • Токсико-аллергические. Крапивница, отек Квинке.

Лечение лямблии подчас превращается в длительный процесс, поэтому с целью предупреждения заражения необходимо:

  • учитывать способы заражения паразитами, соблюдая правила личной гигиены;
  • использовать в пищу исключительно фильтрованную питьевую либо кипяченую воду;
  • проводить обследования контингента и персонала детских учреждений дважды в год, а при обнаружении случаев заболевания также обследовать членов семьи инфицированного;
  • систематически осуществлять профилактические мероприятия в отношении домашних животных (в т. ч. применение ветеринарных медикаментов по крайней мере раз в 6 месяцев).

Лечение лямблии травами и растительными плодами

Преимущества народных способов лечения, гомеопатических препаратов, БАДов:

  1. Средства нетрадиционной медицины натуральны и в основном безопасны для любых возрастных категорий.
  2. Организм способен их аккумулировать без вредных последствий, что щадит печень.
  3. Подходят в качестве профилактических методов лечения.
  4. Появление аллергической реакции маловероятно.
  5. Минимум побочных явлений.
  6. Доступность.

Именно поэтому при борьбе с паразитами современные доктора все чаще обращаются к рецептам лекарств растительного, а не синтетического происхождения. Однако больные обязаны строго следовать дозировкам, придерживаться советов и требований врачей. Так, лечение лямблии в домашних условиях посредством фитотерапии обычно стартует с наименьшей дозировки, которая осторожно увеличивается. Актуален при этом грамотный подбор травяных материалов под наблюдением специалиста.

Рецепты народной медицины при лечении лямблиоза

Отвар из пижмы

Ингредиенты:

  • пижма — 1 ст. ложка;
  • кипяток — 0,5 литра.

Способ приготовления:

Ложку сушеного цвета пижмы залить полулитром кипятка, оставить настаиваться.

Пить 5 дней по трети стакана за 15 мин. до приема пищи.

Рекомендовано в этот период употреблять также свежую голубику, которая ускорит выздоровление.

Отвар из укропа

Ингредиенты:

  • семена укропа — 1 ч. ложка;
  • семена тмина — 1 ч. ложка.

Способ приготовления:

Столовую ложку смеси семян тмина и укропа смешать с кипятком “один к одному”, оставить настояться и остыть. Выпивать по чайной ложке три раза в день, запивать водой. Длительность курса – исходя из тяжести заболевания.

Отвар из березовых почек

Ингредиенты:

Способ приготовления:

Ложку высушенных первых березовых почек заварить в 0,5 л кипятка, оставить остывать, процедить. Выпивать по 50 г за 30 мин. до приема пищи 30 суток.

Отвар из травяной смеси

Ингредиенты:

Способ приготовления:

Смешать все травы, заварить столовую ложку травяной смеси в половине литра кипятка. По полстакана по утрам и вечерам за 30 мин. перед едой: 14 суток – такой же период пауза, затем повторить. Можно использовать произвольное количество.

Эффект достигается через месяц, а в целях профилактики желательно повторить по истечении года.

Отвар или порошок из полыни

Полынь является одним из самых эффективных средств по борьбе с лямблиями, а также она нормализует работу желчного пузыря и способствует выведению желчи из печени.

Ингредиенты:

Способ приготовления:

Залить полынь стаканом кипятка и оставить настаиваться несколько часов, процедить. Пить натощак в течение недели.

Можно также принимать порошок из полыни — 1 столовую ложку сухой полыни принимают за полчаса перед едой, тщательно запивая водой.

Чтобы предотвратить заболевание, нужно помнить об основных правилах гигиены и придерживаться безопасности при контакте с животными. Использование народных средств помогает не только быстро излечиться от лямблии, но и снять симптомы, поэтому растения и травы пользуются таким спросом.

Текущий рейтинг: 4.13 из 5.    Количество голосов: 263

причины, симптомы, диагностика и лечение| Hill’s

Согласно данным Роспотребнадзора, в Российской Федерации ежегодно регистрируется более 70 тыс. случаев заболевания лямблиозом, которое является одним из самым распространённым среди населения паразитарным заболеванием ЖКТ. К сожалению, лямблии бывают и у пушистых питомцев. Можно ли заразиться от кошек лямблиями?

Лямблии иногда путают с кишечными червями, но на самом деле это тип паразитов, относящихся к простейшим, которые проникают в желудочно-кишечный тракт. Хотя этот паразит может вызвать тяжёлую диарею, лечение лямблиоза у кошек, как правило, очень эффективно и имеет хороший прогноз.

Откуда появляются лямблии у кошек

Механизмы, с помощью которых лямблии вызывают заболевание у кошек, изучены ещё недостаточно. Большая часть информации, на которую опираются ветеринарные специалисты, основана на исследованиях лямблий у людей. Считается, что кошки заражаются лямблиями при проглатывании незрелого организма. Попав в кишечник кошки, этот организм превращается в цисту. В итоге кошка выделяет со стулом ещё больше инфицированных цист. Если другие кошки контактируют со стулом заражённой, соответственно с лямблиями в кале кошки, они тоже могут заразиться. Кошка также может проглотить лямблий из загрязнённой питьевой воды, луж или прудов.

Лямблиоз у кошек: симптомы

У многих кошек, инфицированных лямблиозом, заболевание протекает бессимптомно. Питомцы не проявляют никаких признаков болезни. А котята, пожилые кошки и кошки, находящиеся в состоянии стресса, имеющие ослабленную иммунную систему или живущие в тесноте, чаще всего проявляют признаки клинического заболевания. Среди них — водянистая диарея в тяжёлой форме и снижение веса. Если лямблиоз не лечить, он может привести к летальному исходу.

Диагностика лямблиоза у кошек

Анализ на лямблиоз у кошек представляет собой микроскопическое исследование кала на наличие яйцеклеток и паразитов. Иногда паразитов можно увидеть в прямом мазке кала. При подозрении на лямблиоз ветеринарный врач проверит кровь или кал кошки на наличие специфических антигенов лямблий. Эти исследования более точны, чем анализ кала, но занимают больше времени — образец обычно необходимо отправлять во внешнюю лабораторию.

Лямблиоз у кошек: схема лечения

Ни одно лекарство в США не было официально одобрено для лечения лямблиоза у кошек. Однако стандартный метод лечения предусматривает приём метронидазола — антибиотика, который кошке обычно приходится принимать в течение пяти – семи дней. Ветеринарный врач может предложить другое аналогичное лекарство, например альбендазол или фенбендазол.

Как избавиться от лямблий

Если у кошки диагностирован лямблиоз, необходимо продезинфицировать дом, чтобы не допустить повторного заражения животного или себя самого. Для очистки можно использовать разбавленный раствор хлорного отбеливателя в соотношении 1:16. Кроме того, можно обработать спальное место кошки паром или провести химическую чистку дезинфицирующим средством, содержащим четвертичный аммоний. Цисты лямблий легко погибают в сухости, поэтому это место лучше держать максимально сухим в течение нескольких дней.

Лямблии могут находиться и в шерсти кошки. Лучшим способом удалить организмы с шерсти питомицы является купание с шампунем для домашних животных и тщательным ополаскиванием. После этого необходимо снова искупать кошку с дезинфицирующим средством на основе четвертичного аммония. Средство может оставаться на шерсти не более трёх – пяти минут, так как продолжительный контакт с этим химическим веществом может вызвать раздражение кожи и слизистых оболочек кошки. 

После купания нужно тщательно смыть средство, уделяя пристальное внимание области вокруг ануса. Поскольку в большинстве случаев купание кошки — дело непростое, поручить его можно ветеринарному врачу. Если животное слишком нервничает, специалист может назначить мягкую седацию.

Вакцинация и профилактика

На сегодняшний день ни один препарат не зарекомендовал себя в качестве надёжного средства профилактики лямблиоза у кошек. Несмотря на существование известной вакцины против лямблий, достаточных доказательств её эффективности нет. По результатам одного из исследований, молодые котята, получившие вакцину, были невосприимчивы к инфекции через 6–12 месяцев, но при этом вакцина вызывала местные реакции. Другие исследования показывают, что вакцина может оказаться неэффективной у ранее инфицированных кошек и не поможет предотвратить повторное заражение.

Лучшая профилактика лямблиоза — это контроль окружающей среды, который включает дезинфекцию потенциально заражённых мест в доме и удаление организмов паразита с шерсти животного. При любых изменениях в поведении и самочувствии кошки следует связаться с ветеринарным врачом, чтобы узнать его экспертное мнение.

Читайте также:

Гельминтоз у кошек: симптомы и лечение

Всё, что нужно знать о кошачьих блохах

Блохи и глисты

Contributor Bio

Доктор Лэйси Шейбл

Доктор Лэйси Шейбл — ветеринарный врач, специализирующийся на мелких животных; ветеринарный писатель. Она является обладателем множества наград за обучение владельцев домашних животных и считается ведущим ветеринарным экспертом телемедицины.

Лямблиоз: симптомы, диагностика и лечение

16 февраля 2022

Лямблиоз — это паразитарное заболевание обусловленное  заражением простейшими одноклеточными паразитами – лямблиями (L. Intestinalis).

Как происходит заражение?

Источником инфекции являются больные люди, кошки,  собаки, мышевидные грызуны.  Возбудитель попадает в организм с водой из открытых источников, с водопроводной водой,  через предметы обихода, обсемененные цистами лямблий при употреблении инфицированных цистами пищевых продуктов, особенно без термической обработки (овощи, ягоды, фрукты зелень).

Симптомы лямблиоза

В организме человека лямблии существуют в двух формах. В виде вегетативной формы они находятся преимущественно в верхних отделах тонкой кишки, откуда  лямблии  заползают в желчевыводящие пути. При попадании в толстую кишку лямблии превращаются в цисты (споровая форма), которые с испражнениями выделяются во внешнюю среду. Во влажных условиях цисты сохраняют свою жизнедеятельность до 70 дней, в почве – до 9-12 дней, а при недостатке влаги 4-5 дней. При массивной инвазии лямблиоз протекает с выраженной клинической симптоматикой, имеет острое или хроническое течение.

Заболевание может протекать с преобладанием кишечной симптоматики – развивается диспептический синдром: неустойчивый стул, чередование запоров и поносов, боли, вздутие живота, тошнота, а также возможно снижение массы тела.

При преобладании гепатобилиарной симптоматики, больных беспокоит горечь во рту, тянущие боли в правой подвздошной области. Нередко поражение желчевыводящих путей сочетается с гастритом, гастродуоденитом, панкреатитом.

При астеноневротической форме лямблиоза симптомы со стороны желудочно-кишечного тракта выражены умеренно или слабо. На первый план выступают головные боли, раздражительность, утомляемость, нарушение сна.

Токсико-аллергическая форма болезни характеризуется более частыми острыми аллергическими состояниями (крапивница, отек Квинке). Течение острого аллергоза при лямблиозе упорное и затяжное.

Симптомы могут сочетаться, могут носить перемежающийся характер.

Как подтвердить диагноз?

Цисты лямблий можно обнаружить в кале в ходе копологического исследования, в дуоденаньном содержимом, в крови обнаруживают специфические Ig к лямблиям.

Лечение лямблиоза

Как правило, лечение проводится в три этапа: подготовительный, противопаразитарный, восстановительный. Нельзя заниматься самолечением. Дозы препаратов рассчитываются индивидуально инфекционистом. Подбор препаратов учитывает возраст, продолжительность заболевания, сопутствующие болезни.

Профилактика лямблиоза

Для профилактики лямблиоза необходимо употреблять только фильтрованную или кипяченую воду. Промывать овощи, ягоды, зелень перед употреблением. Проводить в организованных детских коллективах обследование детей и персонала 2 раза в год, а при выявлении лиц, выделяющих цисты лямблий, лечить всех членов семьи. Людям, имеющим домашних животных, регулярно проводить антигельминтные обработки. Соблюдать гигиену.

Читайте также:

Лямблиоз у собак — симптомы и лечение

Лямблиоз у собак – патология, вызванная паразитами (относят к простейшим, Lamblia spp.) Болезнь сопровождается рядом функциональных нарушений, имеет несколько форм – носительство, острое и хроническое состояние. Инкубационный период – от 6 до 21 дня.

Важно! Вопрос постановки диагноза остается весьма сложным. Правильно определить болезнь и разработать адекватный алгоритм лечения может только специалист – практикующий врач-ветеринар. С этой целью, помимо внешнего осмотра и сбора анамнеза назначается ряд исследований.

Симптомы лямблиоза у собак

Клинические признаки болезни напоминают следующие патологии:

  • Ряд заболеваний органов желудочно-кишечного тракта.
  • Дисбактериоз с нарушением баланса микрофлоры кишечника.
  • Мальабсорбциию, следствие сбоя процесса пищеварения и усвоения питательных компонентов из пищи.
  • Дефицит поливитаминов из-за неправильного/несбалансированного питания.
  • Аллергические проявления, вызванные рецидивирующим атопическим дерматитом, гастроинтестинальной формой аллергии на продукты питания.
  • Сухую и жирную себорею, нарушение кератинизации и пр.

Важно! Если при наличии первых настораживающих признаков владелец собаки не обратиться к ветеринару для проведения грамотного лечения, болезнь перейдет в хроническую форму и сложнее поддастся коррекции.

Как протекает заболевание?

Острая форма. Жидкий стул, боли в животе, температура повышается редко.

Другие симптомы:

  • Ухудшение аппетита.
  • Рвота, тошнота.
  • Вздутие живота.

Такое состояние может длиться около недели, затем признаки постепенно исчезают (быстрее, если животное получало энтеросорбенты).

Хроническое заболевание. Длительное течение характеризуется:

  • выпадением, а также тусклостью и ломкостью шерсти;
  • изменением цвета кожи на грязный оттенок;
  • жирной себореей;
  • отрыжкой с запахом тухлых яиц;
  • плохим запахом из пасти;
  • налетом на языке;
  • глубокими складками и трещинами на губах.

При наличии иммунодефицита заболевание протекает тяжелее, животное теряет вес, появляются признаки истощения, рахита, повышенное слюнотечение, зуд кожи, эритема, упорный блефарит или хронический отит.

Чем опасен лямблиоз?

При отсутствии грамотного лечения:

  • Нарушаются процессы регенерации эпителия органов ЖКТ.
  • Повышается проницаемость стенок кишечника.
  • Происходит отравление продуктами жизнедеятельности и распада простейших.
  • Запускается механизм пищевой аллергии со всеми вытекающими последствиями.
  • Страдает пищеварение, нарушается стул и т.д.

Все функциональные сбои в совокупности способствуют развитию значительного дефицита жизненно важных компонентов (микронутриенты, поливитамины и минералы, особенно кальций) и ухудшению общего состояния организма животного.

Пути передачи, профилактика и лечение

Основной источник заражения – инфицированные животные, а также больной человек.  Возбудитель заболевания Lamblia spp. обнаруживается в фекалиях, местах выгула животных, водохранилищах. При этом именно вода – это основной путь передачи (возбудитель устойчив к хлорированию, обеззараживания воды можно достичь путем кипячения или фильтрованием через специальные системы водоканала).

Лечением собак с лямблиозом должен заниматься только специалист. Врач выставляет диагноз, назначает лекарства и определяет меры профилактики после осмотра животного и проведения диагностических мероприятий.

Смотрите также:

Лямблиоз

Лямблиоз (английское название — Giardiasis) — протозойная инвазия, протекающая чаще как бессимптомное носительство, иногда с функциональными расстройствами кишечника.

Встречается повсеместно; наибольшую поражённость населения отмечают в странах с тропическим и субтропическим климатом. В этих странах лямблия — один из наиболее частых возбудителей диареи путешественников. В нашей стране большую часть инфицированных (70%) составляют дети дошкольного и младшего школьного возраста.

Подавляющее большинство инфицированных становятся бессимптомными носителями лямблий.

Источник. Источник заражения — человек, выделяющий с фекалиями зрелые цисты лямблий. Возможность заражения человека штаммами Giardia lamblia от животных – собак, кошек, кроликов – в настоящее время не имеет достаточных доказательств.

Механизм передачи. Фекально-оральный, водный. Степень загрязнения фекалиями окружающей среды — решающий фактор в уровне поражённости населения лямблиозом. В детских учреждениях большое значение имеет контактно-бытовой путь заражения. Цисты лямблий обнаружены в кишечнике некоторых насекомых (мух, тараканов, мучных хрущаков), которые могут способствовать их распространению.

Клинические проявления. Инкубационный период длится от 7 до 28 дней.

Наиболее частые проявления первичной инфекции:

  • Тошнота,

  • Отсутствие аппетита,

  • Вздутие кишечника, боли и урчание в животе,

  • Стул учащённый, зловонный, возможна рвота.

Эта форма лямблиоза в гигиенических условиях купируется в течение нескольких дней, хорошо поддаётся химиотерапии, но без специфического лечения может приобретать затяжное течение.

Острый период длится несколько дней, после чего лямблиоз чаще переходит в подострую или хроническую стадию с кратковременными обострениями в виде жидкого стула и вздутия кишечника, похудания, повышенной утомляемости.

В случае повторного инфицирования или хронического течения инфекции, болезнь может протекать месяцами и годами с периодическими обострениями в форме гастродуоденита, дискинезии желчного пузыря.

Известны клинические формы лямблиоза с аллергическими проявлениями в виде крапивницы с кожным зудом, или с приступами бронхиальной астмы. У детей нередки невротические симптомы: слабость, быстрая утомляемость, раздражительность, плаксивость, головные боли.

Диагностика. Для лабораторной диагностики исследуют фекалии или дуоденальное содержимое (содержимое кишки: смесь желчи, желудочного сока, секрета поджелудочной железы и т.д.). Как правило, эти специфические анализы берутся в условиях дневного стационара.

Лечение. Лечение амбулаторное или стационарное, в зависимости от формы и тяжести протекания болезни. Используют химио- и симптоматическую терапию.

Профилактика. Основными мерами являются:

  • защита водоёмов от фекального загрязнения и обеспечение качественного водоснабжения;

  • предотвращение загрязнения пищевых продуктов;

  • раннее выявление и лечение больных и бессимптомных носителей;

  • систематическое санитарное просвещение;

  • обязательное кипячение воды — более эффективный метод уничтожения цист лямблий по сравнению с применением химических средств.

Во время поездок за рубеж, особенно в страны тропического и субтропического климатического поясов, необходимо использовать для питья и при чистке зубов только бутилированную или кипяченую воду, стараться не употреблять напитки со льдом, не заглатывать воду во время водных процедур.

Куда обращаться?

При обнаружении подозрительных симптомов необходимо обратиться за первичной консультацией к врачу-специалисту

Также на первичный прием к специалисту можно записаться в поликлинике по месту прикрепления. Для этого необходим паспорт и полис ОМС.

Лямблиоз лечение 🌟 Поликлиника №1 РАН

Лямблиоз – это инфекционное кишечное заболевание, которое вызывает одноклеточный паразит Лямблия Интестиналис. К специфическим осложнениям инфицирования относят аллергические реакции в виде ангионевротического отека или крапивницы, поражение органа зрения, реактивные артриты, специфическая гипокалиемическая миопатия, а также неспецифические – обезвоживание, присоединение интеркуррентных заболеваний.

Заражение лямблиозом происходит из внешней среды при попадании цист возбудителя. Передача заболевания реализуется фекально-оральным механизмом, преимущественно водным путем – при употреблении некипяченой воды, при мытье некачественной водой посуды, фруктов или овощей. В детских организованных коллективах передача заболевания может происходить непосредственно от человека к человеку. При попадании в организм цисты локализуются в области слизистой верхнего отдела тонкого кишечника, вегетативные формы располагаются пристеночно, блокируют пищеварительные процессы за счет подавления ферментативной активности и нарушают моторику кишечника. Возможность продукции специфического токсина лямблиями до настоящего времени остается недоказанной. Лямблиоз также приводит к повышению размножения бактерий и дрожжевых грибов в просвете кишечника, что может ухудшать течение болезни. Клиническая картина заболевания развивается при массивной инвазии, выраженной вирулентности возбудителя или снижении иммунного статуса. Клинические формы лямблиоза могут быть с преимущественным поражением пищеварительной системы – энтерит или гастрит, с нарушением функции поджелудочной железы и желчных протоков, а также с преобладанием гематологических, аллергических, неврологических или других синдромов.

Клиническая картина чаще всего неспецифична и ограничивается симптомами поражения желудочно-кишечного тракта, аллергическими и интоксикационными проявлениями. При поражении кишечника возникают боли в животе, тошнота, анорексия, чередование обстипации и диареи, изжога, отрыжка, повышенное слюнотечение, метеоризм, урчание в животе, быстрая утомляемость, слабость, раздражительность, нарушения сна, головные боли, повышение температуры тела, потеря веса. Могут отмечаться симптомы нарушения функции поджелудочной железы и желчных путей – боли в правом или левом подреберье, тошнота, рвота. Из аллергических проявлений могут быть поражения кожных покровов, бронхообструктивный синдром, повышение эозинофилов в крови. По течению заболевания выделяют острый, подострый и хронический вариант, неосложненный и осложненный лямблиоз, а также по степени тяжести – легкую, среднетяжелую и тяжелую инфекцию.

Диагностикой и лечением лямблиоза занимается врач-терапевт, гастроэнтеролог, при необходимости показана консультация инфекциониста, иммунолога-аллерголога, невролога.

Всем пациентам помимо выявления жалоб, эпиданамнеза и объективного обследования показано выполнение общего анализа крови и мочи, биохимического анализа крови и бактериологического исследования кала. Для постановки диагноза лямблиоза «золотым стандартом» служит определение цист в образце кала или вегетативных форм в содержимом тонкого кишечника. Могут применяться также методики определения генетического материала или антигенов возбудителя в кале, а также серологическая диагностика – определение специфических антител в сыворотке крови. При наличии показаний могут проводиться дополнительные методы обследования.

Обследование на лямблиоз может быть показано в следующих ситуациях: длительная диарея или тошнота неясной этиологии, анорексия, снижение настроения и повышенная утомляемость в сочетании с симптомами поражения ЖКТ, рецидивирующие аллергические состояния – крапивница, аллергический дерматит, экзема, бронхообструктивный синдром, длительный субфебрилитет. Профилактическое обследование показано в таких группах лиц, как дети дошкольных образовательных учреждений и персонал — один раз в год; декретированные группы лиц при поступлении на работу и при периодических осмотрах; контактные лица; дети – при оформлении в новое учреждение.

При проведении лечения показано соблюдение санитарно-эпидемического режима, диетических назначений и прием противолямблиозных препаратов. Симптоматическое лечение может включать регидратацию, энтеросорбенты и пробиотики при выраженной диарее, панкреатические ферменты, спазмолитики, жаропонижающие, десенсибилизирующие. После купирования острых проявлений на этапе восстановления показан прием гепатотропных и желчегонных средств, фитопрепаратов, поливитаминов, про- и пребиотиков. Контроль излеченности включает проведение через 2-3 недели после окончания курса терапии копрологического исследования, ПЦР или определение лямблий в кале и выполнение биохимического анализа крови.

Лечение лямблиоза в Житомире — медицинский центр Оксфорд Медикал

Лямблиоз — это инфекционное протозойное заболевание, которое вызывает функциональные расстройства двенадцатиперстной кишки и органов пищеварения. Большинство людей, у которых имеются лямблии, не жалуются на симптомы, поэтому даже не подозревают у себя данной патологии.

Особенности возбудителя лямблиоза, эпидемиологическая характеристика

На сегодняшний день, лямблии считаются одним из самых распространенных инфекционных возбудителей, передающихся водным путем. Лямблия — это одноклеточная простая форма жизни, развивается в двух стадиях — вегетативной и цистовой. Внешне вегетативная форма напоминает грушу с вытянутым задним концом. Впереди есть специальный присосок, что позволяет закрепиться лямблии на стенке кишечника. Размножается этот паразит продольно. Вегетативная форма является неустойчивой в окружающей среде и быстро погибает. Циста — это форма, имеющая двойную защитную оболочку, которая делает ее гораздо более устойчивой во внешних условиях. Цисты могут выживать в испражнениях и воде несколько недель, в почве — даже полгода. Они не чувствительны к действию дезинфицирующих растворов.

Источником лямблиоза является больной пациент и бессимптомные носители, которые выделяют цисты в окружающую среду с испражнениями. В здоровый организм эти цисты попадают с грязными руками, из-за употребления немытых овощей и загрязненной воды. Также некоторые насекомые могут стать механическим переносчиком цист (мухи и тараканы). Наиболее восприимчивы организмы — дети, что обусловлено проблемами с гигиеной.

Симптоматика лямблиоза

Проникает возбудитель, как мы заметили, фекально-оральным механизмом. Проникнув через ротовую полость, лямблия без каких-либо трудностей преодолевает кислотную среду желудка и поселяется в 12-перстной кишечнике. Нарушение желчеобразования способствует проникновению возбудителя в желчные протоки и желчный пузырь. Патогенетически лямблии провоцируют:

  • поражение стенки органов, на которых они паразитируют;
  • развитие местных воспалительных изменений;
  • нарушение ферментной функции;
  • сенсибилизация организма человека своими продуктам обмена и токсинами, что может даже привести к развитию аллергической реакции;
  • нарушение пристеночного пищеварения.

Симптоматическое течение лямблиоза может быть латентным (бессимптомное) или манифестным. Манифестное течение проявляется болями в животе, явными признаками расстройств пищеварения, общим недомоганием, вздутием, диареей. Длительное пребывание лямблий провоцирует дальнейшее развитие гастроэнтерита, дуоденита, хронической дисфункции кишечника, дискинезии желчного пузыря и протоков.

Внешне отмечаются признаки слабости и анемии, апатии, вегето-сосудистой дисфункции. Развивается аллергический синдром из-за чрезмерной сенсибилизации токсинами лямблий. Он проявляется сыпью на коже, дерматитами, астматическим бронхитом.

Специфическая диагностика и лечение лямблиоза

Диагностикой и лечением лямблиоза занимается врач-инфекционист. Заподозрить патологию можно благодаря эпидемиологическому анамнезу пациента, жалобам. Врачи сразу назначают специфические методы обследования для дифференциации патологии с гельминтозами. Назначается паразитоскопия — выявление цист лямблий под микроскопом в испражнениях, дуоденальном содержимом. Данное обследование следует проводить не менее 3 раз с интервалом 1-2 дня, чтобы избежать погрешности через цикл развития лямблий. Серологическая диагностика пока не целесообразна, ведь антитела могут сохраняться в организме и при отсутствии лямблий.

Для лечения лямблиоза назначают специфические антипротозойные препараты и общую симптоматическую терапию, которая заключается в усилении иммунного ответа, ликвидации расстройств пищеварительной системы, ликвидации последствий деятельности лямблий. Также включают сорбенты, желчегонные препараты, обволакивающие средства. Курс лечения формируется индивидуально для каждого пациента.

Интересует? Позвони нам! 

ЗАПИСАТЬСЯ НА ПРИЕМ

Лечение лямблиоза

При оценке клинической эффективности средств, применяемых против Giardia , трудно сравнивать исследования. Они различаются по методологии включения (была ли проведена рандомизация и было ли лечение слепым или открытым), изучаемой популяции (дети, взрослые, симптоматические и/или бессимптомные пациенты), показателям результатов (клиническая эффективность и/или отрицательный анализ стула) и продолжительности лечения. следовать за. Тем не менее, если рассматривать исследования в целом, можно сделать выводы и сделать выводы об относительной эффективности препаратов.

Классы агентов и клинические свойства

Нитроимидазолы.

Класс нитроимидазолов, используемых для лечения инфекции G. lamblia , включает метронидазол, тинидазол, орнидазол и секнидазол. Этот класс был открыт в 1955 г. и показал высокую эффективность против нескольких протозойных инфекций 240. Метронидазол [1-(β-гидроксиэтил)-2-метил-5-нитроимидазол; Flagyl] был определен как терапевтический против Trichomonas vaginalis и Entamoeba histolytica после его открытия в конце 1950-х годов 67, а в 1962 году Darbon et al.сообщили, что его можно использовать для лечения лямблиоза 57. С момента этого открытия клиницисты использовали метронидазол и другие нитроимидазолы в качестве основы для лечения лямблиоза.

Из нитроимидазолов наиболее тщательно изучен механизм уничтожения Giardia метронидазолом. Метронидазол использует анаэробные метаболические пути, присутствующие в Giardia . Лекарство проникает в трофозоит, и как только он оказывается внутри клетки, электронтранспортные белки ферредоксины от паразита отдают электроны нитрогруппе лекарственного средства 223, 238, 244.Лекарство «активируется» восстановлением этой нитрогруппы 223, 238, 240, и в результате этой реакции восстановления устанавливается градиент, благоприятствующий внутриклеточному транспорту метронидазола. Восстановленный метронидазол служит терминальным акцептором электронов, который ковалентно связывается с макромолекулами ДНК 72, 177. Это приводит к повреждению ДНК в виде потери спиральной структуры, нарушению функции матрицы и обрыву цепи с последующей гибелью трофозоитов 95. В дополнение к этому эффект, метронидазол ингибирует дыхание трофозоитов 81, 189.Восстановительная активация метронидазола может также приводить к образованию токсичных радикалов, которые реагируют с основными клеточными компонентами 244. Нитроимидазолы могут меньше влиять на трофозоиты внутри кист, возможно, из-за плохого проникновения лекарства через стенку кисты 236. Резистентность к метронидазолу индуцируется у vitro 29. Это коррелирует со снижением активности пируват:ферредоксин оксидоредуктазы паразита, которая необходима для восстановительной активации нитроимидазолов 239, 247.

Метронидазол быстро и полностью всасывается после перорального приема и проникает в ткани организма и выделения, такие как слюна, грудное молоко , сперма и вагинальные выделения 240.Препарат метаболизируется в основном в печени и выводится с мочой 147.

Анализы in vitro на чувствительность к нитроимидазолу проводились с G. lamblia с 1980 г. 112. Используя микроскопическую оценку морфологии и подвижности паразита, Jokipii и Jokipii впервые продемонстрировали эффективность метронидазола и тинидазола 129. Впоследствии, морфология 13, 166, 175, ингибирование роста 56, 69, 94, 116, 160, 225, включение [ 3 H]тимидина 32, 117, 164, уничтожение сыворотки 114 , витальное исключение красителя 114, 235, ингибирование прилипания 21, 55, 79, 166, 192, метаболический анализ 228 и колориметрический анализ 133 использовались для измерения in vitro реакции препарата на многие терапевтические агенты.Однако, как показывает разнообразие используемых анализов, не существует стандарта для тестирования in vitro, что затрудняет сравнение результатов и применение результатов in vitro в клинических условиях.

Из нитроимидазолов тинидазол и метронидазол постоянно демонстрируют наибольшую активность in vitro; тинидазол обладает небольшим преимуществом 30, 32, 55, 101. Более высокозамещенные нитроимидазолы, такие как миконазол, клотримазол, итраконазол и кетоконазол, были разработаны из-за их противогрибковой активности и не являются эффективными средствами против G.lamblia 55. Чувствительность к нитроимидазолам может варьироваться в зависимости от штаммов и клонов G. lamblia , используемых в тестировании 29, 31, 79, 160.

В США метронидазол является единственным представителем класса нитроимидазолов, доступным для лечить лямблиоз; это также наиболее распространенный препарат, используемый для лечения во всем мире. Несмотря на его широкое и общепринятое использование против Giardia , Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США никогда не одобряло его для этого показания. В клинических испытаниях применяли дозирование два и три раза в день (обычно 250 мг/доза) в течение 5–10 дней и короткий курс (1–3 дня), однократную ежедневную терапию (2.0 или 2,4 г/доза) 261. При 5-10-дневном режиме лечения эффективность колеблется от 60 до 100 % у взрослых и детей, при этом медиана эффективности в обеих группах составляет 92 % (таблица) 20, 49, 68. , 91, 92, 100, 127, 132, 135, 150, 151, 191, 201, 202, 232, 256. В целом этот график хорошо переносится, с большинством побочных эффектов, связанных с желудочно-кишечными расстройствами и металлическим привкусом (таблица).

Таблица 1

Таблица 1

Эффективность препаратов Анти- Гиардиа У взрослой и детской инфекции A

–2,4 г, разовая доза

9009 0 1

Таблица 2

Таблица 2

Рекомендуемое дозирование и неблагоприятное воздействие анти- Гиардиа препараты

Препарат
Препарат Доза B Средняя эффективность (%) C Диапазон эффективности (%) )
Метронидазол 500–750 мг/день × 5–10 дней 88 60–95 7 2 0059
48 36–60
2,0–2,4 г, 4 раза в сутки × 2 дня 71 67–80
2,0–2,4 г, 4 раза в сутки. × 3 дня 93-100 93-100
15-22,5 мг / кг / день × 5-10 дней D 94
Tinidazole 300 мг / день × 7 дней 87 74–100
1.0-2,0 г, одна доза 92 86-100 86-100
50 мг / кг, одиночная доза D 91 91 80-96
Орнидазол 1.0-2,0 г , Одноместный доза 96-100
40-50 мг / кг, одна доза D 92-100
Secnidazole 2,0 г, одна доза 86-100
30 мг / кг, 1 или 2 дозы D 88-100 88-100
Quinacrine 300 мг / день × 5-7 дней 95 -100
6-8 мг / кг / день × 5-10 дней D 92-95 92-95
Furazolidone 400 мг / день × 7-10 дней 80–85
8 мг/кг/ День × 7-10 дней D 92 81-96 81-96
albendazole 200-800 мг / день × 1-3 дня 24-81
200- 400 мг / день × 5-7 дней 94-100 94-100
Paromomycin
10-50 мг / кг / день или 1500 мг / день × 5-10 дней 55-88
Бацитрацин цинка 240 000 u / день × 10 дней 95
95
B
препарат Взрослый доза f Детская доза Побочные эффекты
Метронидазол a 250 мг t.я бы. × 5–7 дней 5 мг/кг 3 раза в день × 5-7 дней головная боль, Vertigo, тошнота, металлический вкус, urticaria
дисульфирам-подобной реакции с алкоголем 10070
редкий: панкреатит, центральный нервный системная токсичность, обратимая нейтропения, периферическая нейтропатия, уплощение зубца Т при длительном применении
Мутагенный/канцерогенный?
Tinidazole B 2 г, одна доза 50 мг / кг, одна доза (макс, 2 г) как для Metronidazole
Ornidazole C 2 г, одна доза 40–50 мг/кг, разовая доза (макс. 2 г) То же, что и метронидазол
Хинакрин c 100 мг t.я бы. × 5–7 дней 2 мг/кг 3 раза в день × 7 дней тошнота и рвота, головокружение, головная боль
редко: токсичный психоз
Furazolidone д 100 мг четыре раза в день × 7–10 дней 2 мг/кг 4 раза в день × 10 дней Тошнота, рвота, диарея
Коричневое окрашивание мочи; дисульфиры-подобная реакция с употреблением алкоголя
реагирует неблагоприятно с ингибиторами МАО
Мягкого гемолиза при дефиците G6PDH
Канцерогенных?
Паромомицин a 500 мг t.я бы. × 5–10 дней 30 мг/кг/день в 3 приема × 5–10 дней Ототоксичность и нефротоксичность при системном введении
Альбендазол a 400 мг 4 раза в сутки × 5 дней 15 мг / кг / день × 5-7 дней (макс, 400 мг) анорексия, запор
редко: обратимые нейтропения и повышенные функции печени
Тератогенный?
Бацитрацин цинк e 120 000 U b.я бы. × 10 дней не проверено у детей до 10 лет тошнота, рвота, брюшной дискомфорт
нефротоксичность с системным поглощением

Одно доза, краткосрочные процедуры высокая доза ежедневно) были разработаны для улучшения соблюдения режима лечения без ущерба для эффективности. Их применяли как у взрослых, так и у детей. Эти схемы, как правило, менее эффективны, особенно если вводится только одна доза метронидазола.Эффективность однократной терапии колеблется от 36 до 60% при назначении препарата в течение 1 дня 16, 93, 127, 130, 220, 229 и повышается до 67–80% при назначении препарата в течение 2 дней (табл. ). 127, 130, 146; Э. Грин, Д. М. Линч, Дж. А. Макфадзин и И. М. Пью, Письмо, Бр. Мед. J. 2: 411–412, 1974). Продолжение однократной дозы в течение 3 дней увеличивает эффективность до уровня, наблюдаемого при более низких дозах и более длительном курсе терапии 229; Грин и др., письмо). Схемы с высокими дозами также могут иметь больше побочных эффектов 127.

Дети были включены во многие испытания как длительного, так и короткого курса терапии, с результатами, аналогичными таковым у взрослых, и эффективностью от 80 до 100% (медиана 94%) при 5-10-дневных схемах лечения 91 , 100, 132, 135, 186, 201, 232; А. Растегар-Лари и А. Салек-Могхаддам, Письмо, J. Trop. Педиатр. 42: 184–185, 1996). Хотя метронидазол не выпускается в стандартной жидкой форме, суспензию можно приготовить путем тщательного измельчения таблеток метронидазола, использования капли глицерина в качестве смазки и суспендирования смеси в вишневом сиропе NF 150.

Наиболее частые побочные эффекты лечения метронидазолом включают головную боль, головокружение, тошноту и металлический привкус во рту (таблица). Тошнота возникает у 5-15% пациентов, получающих стандартные многодневные курсы [135, 151]. Кроме того, метронидазолу приписываются панкреатит, токсическое действие на центральную нервную систему [144, 212] и транзиторная обратимая нейтропения [147]. избегайте употребления алкоголя при приеме метронидазола. Ингибирование альдегиддегидрогеназы метронидазолом может вызвать сильную рвоту, приливы, головную боль и желудочно-кишечные боли после приема алкоголя.

Метронидазол оказывает мутагенное действие на бактерии и канцерогенное действие на мышей и крыс в высоких дозах в течение длительного времени 34, 153, 240, 251. Однако мутагенность у людей никогда не регистрировалась, что позволяет предположить, что использование метронидазола в этом отношении безопасно 23, 78, 98, 212. Это может, однако, смягчить воздействие коротких курсов высоких доз у детей.

Обнаружение терапевтической эффективности метронидазола побудило исследователей разработать и испытать другие производные нитроимидазола.Другие препараты, тинидазол, орнидазол и секнидазол, имеют более длительный период полувыведения, что делает их подходящими для однократной терапии суточными дозами 217. Одна доза тинидазола (Фазигин) была успешно использована в 1971 г. в группе шведских студентов, заболевших лямблиозом. во время визита в Россию 11. Эта однократная доза 2 г (или эквивалент для детей) последовательно доказывала клиническую эффективность от 80 до 100% со средней эффективностью 92% (таблица) 16, 126, 130, 131 , 146, 151, 193, 222, 229, 261; З. Фарид, Н.A. El Masry, W. F. Miner и A. Hassan, Letter, Lancet ii: 721, 1974; Т. Петтерссон, Письмо, Бр. Мед. J. 1: 395, 1975) и намного превосходит метронидазол при прямом сравнении режимов однократной дозы 93, 130, 229, 261. Также наблюдается улучшенное соблюдение этой схемы дозирования. Рекомендуемая доза для детей обычно составляет 50 мг/кг для однократной дозы (таблица) 82, 193, 232, 256, и препарат доступен в виде жидкой суспензии.

Побочные эффекты тинидазола встречаются не так часто, как метронидазол, но включают горечь, головокружение и желудочно-кишечные расстройства (таблица) 130, 131; Петтерссон, письмо).Тинидазол недоступен в Соединенных Штатах, но поставщики медицинских услуг рекомендуют некоторым путешественникам, особенно путешествующим в течение длительного времени или путешествующим по суше в Азии, приобрести препарат по прибытии в страну назначения и принимать его в случае заражения лямблиозом 113.

Другим производным нитроимидазола, которое также недоступно в США, является орнидазол. Было проведено меньше исследований с орнидазолом, но он обладает превосходной эффективностью при приеме в течение нескольких дней и эффективностью, аналогичной тинидазолу (от 92 до 100%), при однократном приеме 19, 131, 145, 220, 232, 261.Однократная доза орнидазола (40 мг/кг) также назначалась детям с очевидными преимуществами в отношении соблюдения режима и стоимости [39, 186]. рутинное использование этого препарата у детей до завершения широкомасштабных исследований рецидивов, канцерогенности и побочных эффектов 39.

Секнидазол, производное 5-нитроимидазола длительного действия, использовался, но недоступен в США.Подобно тинидазолу и орнидазолу, секнидазол обычно назначают однократно. Наиболее распространенная схема составляет 2 г для взрослых и 30 мг/кг для детей 95. Клинические исследования демонстрируют уровень эффективности более 85% при однократном приеме у взрослых 49; Р. Бакай, Х. Куреши и С. Дж. Зубери; Письмо, Дж. Пак. Мед. доц. 45:288, 1995), а у детей эта доза так же эффективна, как 7-10-дневный курс метронидазола 100; Растегар-Лари и Салек-Могаддам, Письмо). Препарат быстро и полностью всасывается, имеет период полувыведения от 17 до 29 часов и метаболизируется путем окисления в печени 95.Сообщалось о побочных эффектах, в первую очередь желудочно-кишечных расстройствах (тошноте, анорексии и боли в животе) и головокружении, но обычно не требующих отмены препарата.

Квинакрин.

Хинакрин (атабрин) был впервые представлен в качестве противомалярийного средства в 1930 году после работы Кикута и стал предпочтительным противомалярийным средством для союзных войск во время Второй мировой войны из-за его большей доступности и лучшей переносимости по сравнению с хинином 240. После войны, вскоре он стал важным агентом против G.lamblia с клинической эффективностью 90% и более 20, 52, 105, 255. Однако, поскольку рынок США ограничен лечением Giardia , использование хинакрина сократилось, и его производство в США было прекращено. в 1992 г., хотя его все еще можно получить из альтернативных источников (таблица).

Противопротозойный механизм хинакрина до конца не выяснен. Препарат легко встраивается в ДНК G. lamblia , и считается, что именно это взаимодействие вызывает ингибирование синтеза нуклеиновых кислот 240.Различная относительная скорость поглощения хинакрина между человеческими и клетками G. lamblia может быть причиной селективной токсичности препарата 236. In vitro хинакрин снижает жизнеспособность цист и скорость их эксцистации 179, 189. Резистентность индуцируется in vitro, а в в одном исследовании это коррелировало со снижением усвоения препарата 246. Квинакрин быстро всасывается из кишечного тракта и широко распределяется в тканях организма.

Хотя результаты различаются в зависимости от используемого теста чувствительности in vitro, было показано, что метронидазол и фуразолидон немного более эффективны, чем хинакрин 30, 32, 55, 94.Однако в других исследованиях in vitro эффективность хинакрина и метронидазола одинакова 21, 117, 164. Некоторые из этих различий могут быть связаны с большей вариабельностью чувствительности к хинакрину, чем к метронидазолу или фуразолидону между клонами Giardia 31.

Клинически хинакрин очень эффективен: исследования показали, что его эффективность в течение 5-10 дней составляет около 95% (таблица) 20, 135, 220, 255. Некоторые исследователи считают этот препарат наиболее эффективным из всех анти- Giardia терапевтические средства 256.Дозировка обычно составляет 100 мг три раза в день в течение 5–7 дней для взрослых и 6 мг/кг/день в три приема в течение 5–7 дней для детей (таблица) 150.

Побочные эффекты не позволяют многим врачам использовать хинакрин. , особенно у детей (таблица). Горький вкус наряду с рвотой отмечался у 28% участников исследования 20, 52 и приводил к более низкой эффективности у детей младше 5 лет 52, вероятно, из-за низкой приверженности лечению. Желто-оранжевое обесцвечивание кожи, склер и мочи наблюдается у 4-5% пациентов, принимающих хинакрин, начиная примерно через 1 неделю после начала лечения и может сохраняться до 4 месяцев после прекращения терапии.Другие распространенные побочные эффекты включают тошноту, рвоту, головную боль и головокружение 254. Лекарственный психоз встречается редко, а эксфолиативный дерматит и ретинопатия, вызванная хинакрином, встречаются редко 82. Хинакрин может усугублять псориаз, а глюкозо-6-фосфатдегидрогеназа (Г6ФДГ) может усугублять течение псориаза. -дефицитные люди, это может вызвать гемолиз. Противопоказан при беременности из-за возможной связи с расщеплением позвоночника и агенезией почек. Никогда не было доказано, что он канцерогенен, хотя он имеет механизм действия связывания с ДНК.

Фуразолидон.

Фуразолидон (фуроксон) является одним из тысяч нитрофурановых соединений, созданных с момента открытия этого класса в 1940-х годах143. Он эффективен против многих бактерий, включая Klebsiella spp., Clostridium spp., Escherichia coli , , Campylobacter spp. и Staphylococcus aureus . Еще в 1950-х годах фуразолидон использовался для лечения лямблиоза 253. Он одобрен для использования в Соединенных Штатах и ​​остается важным терапевтическим средством во всем мире.Из распространенных терапевтических средств против Giardia это единственное, доступное в США в виде жидкой суспензии; поэтому его использование было рекомендовано в педиатрической популяции 150.

Механизм действия фуразолидона против G. lamblia , как и многих противопаразитарных средств, полностью не объяснен. Препарат подвергается восстановительной активации в трофозоите G. lamblia , но, в отличие от метронидазола, восстановление, возможно, происходит с помощью НАДН-оксидазы 38, 244.Его убивающий эффект коррелирует с токсичностью восстановленных продуктов, которые могут повредить важные клеточные компоненты, включая ДНК. Резистентность к фуразолидону может быть связана с уменьшением проникновения лекарственного средства 246 или с повышенным уровнем тиол-циклирующих ферментов, которые могут защищать от токсичных радикалов 249. Лекарственное средство легко всасывается через желудочно-кишечный тракт и быстро метаболизируется в тканях, что приводит к низким концентрациям в сыворотке и моче 143.

В тестах на чувствительность in vitro фуразолидон действует сравнимо с метронидазолом и постоянно демонстрирует самую высокую активность среди неимидазолов 32, 55, 101; он более активен, чем хинакрин 30.

Клинические исследования с использованием фуразолидона многочисленны и были завершены с широким кругом субъектов, доз и графиков введения. Хотя его эффективность обычно считается несколько ниже, чем у метронидазола и хинакрина, сообщалось о показателях излечения от 80 до 96% при 7-10-дневных курсах (таблица) 20, 52, 91, 151, 178, 191. , 201, 255. Когда препарат принимается всего 5 дней, его эффективность значительно падает 151, 178. Его назначают в виде четырех доз в день как взрослым (100 мг на дозу), так и детям (1.5 мг/кг) (таблица). В педиатрической суспензии две столовые ложки заменяют таблетку по 100 мг.

Около 10% пациентов сообщают о желудочно-кишечных симптомах, таких как тошнота, рвота и диарея (таблица ) 150, 256. Другие побочные эффекты могут включать изменение цвета мочи на коричневый; гемолиз может возникать у пациентов с дефицитом G6PDH. Препарат оказывает ингибирующее действие на моноаминоксидазу (МАО), и его никогда не следует назначать одновременно лицам, уже принимающим ингибиторы МАО. Были редкие сообщения о дисульфирамоподобных реакциях при приеме с алкоголем 164b.Сообщалось о маниакальном эпизоде, вызванном фуразолидоном, у пациента, инфицированного вирусом иммунодефицита человека 73. Фуразолидон также противопоказан детям в возрасте до 1 месяца, у которых может развиться гемолитическая анемия из-за обычно нестабильного глутатиона. Наконец, препарат оказывает мутагенное действие на бактерии и, как было показано, вызывает опухоли молочных желез у крыс и опухоли легких у мышей при длительном приеме в высоких дозах. Однако значение этого открытия для человека неизвестно и не было адекватно рассмотрено 143, 164b, 236.При лечении детей преимущества минимальных побочных эффектов и доступности жидкой суспензии необходимо сопоставлять с необходимостью частого введения в течение 10-дневного периода лечения.

Бензимидазолы.

Два представителя класса бензимидазолов, альбендазол (Albenza) и мебендазол (Vermox), использовались для лечения инфекции G. lamblia 155. Клинические исследования и исследования эффективности in vitro дали разные результаты в отношении их эффективности.Однако сравнительно мягкий профиль побочных эффектов в сочетании с доказанной эффективностью против многих гельминтов делает их перспективными для лечения 208, 250. -тубулиновый цитоскелет 71, 175, 209. Это связывание вызывает как ингибирование полимеризации цитоскелета, так и нарушение захвата глюкозы 250. Хотя точное место связывания на цитоскелете не определено, постулируется, что взаимодействие бензимидазол-колхицин может играть определенную роль. 51, 166, 236.Бензимидазолы плохо всасываются из желудочно-кишечного тракта, хотя это можно улучшить при одновременном приеме жирной пищи. Системный эффект альбендазола обусловлен его первичным метаболитом, альбендазолсульфоксидом, который быстро образуется в печени после абсорбции 3. Выведение почками незначительно.

Тестирование in vitro чувствительности G. lamblia к бензимидазолам ограничено по сравнению с чувствительностью паразита к нитроимидазолам или хинакрину.Тем не менее, исследования демонстрируют значительный эффект in vitro 79, 175, 208, 209. В одном отчете показано, что и альбендазол, и мебендазол были в 30-50 раз более активны, чем метронидазол, и в 4-40 раз более активны, чем хинакрин in vitro 71. Другой продемонстрировал, что способность альбендазола влиять на морфологию, прилипание и жизнеспособность трофозоитов была намного выше, чем у метронидазола или тинидазола 166. Однако их переменная клиническая эффективность демонстрирует несоответствие между тестированием in vitro и активностью in vivo.Резистентность к альбендазолу может быть индуцирована in vitro 154 и коррелирует с изменениями в цитоскелете паразита 243. Другие бензимидазолы, такие как нокодазол, оксфендазол, тиабендазол и фенбендазол, также продемонстрировали некоторую эффективность in vitro 236.

Клинические испытания ограничивались альбендазолом и мебендазол со смешанными результатами. Холл и Нахар сообщили о равной лечебной эффективности альбендазола и метронидазола у детей, когда альбендазол назначался в течение 5 дней, но не при однократном или трехдневном приеме (таблица) 104.Снижение эффективности альбендазола при приеме в течение 3 дней или менее также было задокументировано Kollaritsch et al. у путешественников с лямблиозом 137, Pungpak et al. у детей и взрослых 198, и Pengsaa et al. у детей 193. Повышение эффективности наблюдалось у других пациентов, когда препарат назначался в течение 5 дней 171, 207, 214 или 7 дней 198. Исключение в отношении необходимости более длительных курсов лечения наблюдалось в одном исследовании, в котором вводилась однократная доза 68. Комбинация альбендазол-метронидазол была эффективна на 100% у 20 пациентов с резистентным к метронидазолу лямблиозом, у которых от трех до пяти курсов стандартной пероральной терапии метронидазолом не удавалось 44.

Лечение мебендазолом привело к сильно различающимся клиническим результатам. Al-Waili сообщил о более чем 90% эффективности в двух исследованиях у детей 8, 9. Однако другие исследования как у детей, так и у взрослых не показали одинакового успеха, но вместо этого показали эффективность у 80% 211 и у 60% или менее 39, 92 , 132; Л. ди Мартино, А. Ночерино и М. Петтоелло Мантовани, Письмо, пер. Р. Соц. Троп. Мед. Гиг. 85: 557–558, 1991), а также отсутствие снижения показателей распространенности Giardia при использовании мебендазола при массовом лечении гельминтов 219.Из-за этого несоответствия наибольший интерес был сосредоточен на альбендазоле.

Дозировка для взрослых обычно составляет 400 мг в день в течение 5 дней для альбендазола и 200–400 мг в день в течение 5–10 дней для мебендазола (таблица). Обычная доза для детей составляет 15 мг/кг в сутки в течение 5–7 дней. Оба препарата доступны в виде суспензии. Одним из преимуществ использования альбендазола у детей является его эффективность против многих гельминтов, что позволяет эффективно лечить множество кишечных паразитов 207, 208. Другим преимуществом является относительное отсутствие побочных эффектов.Однако при кратковременном употреблении он может вызвать желудочно-кишечные проблемы, такие как анорексия и запор. Длительное применение альбендазола в высоких дозах, например, при личиночных цестодных инфекциях, вызывает обратимую нейтропению и повышение уровня печеночных ферментов [3, 155, 258]. Альбендазол противопоказан при беременности из-за возможного тератогенного действия (категория беременности). C), но исследования на животных не показали увеличения канцерогенной заболеваемости.

Паромомицин.

Паромомицин (хуматин), член семейства аминогликозидов, был впервые выделен в 1956 году.Он показан для лечения Entamoeba histolytica и Trichomonas и был предложен для лечения G. lamblia при резистентных инфекциях и во время беременности 113, 140. Паромомицин плохо всасывается из просвета кишечника; даже при пероральном введении больших доз достигаются лишь минимальные концентрации в крови и моче пациентов с нормальной функцией почек 140. Паромомицин ингибирует синтез белка G. lamblia , вмешиваясь в 50S- и 30S-субъединицы рибосомы (рРНК паразита имеет необычный размер и последовательность) и вызывая неправильное прочтение кодонов мРНК 69.

Анализ чувствительности in vitro показывает, что паромомицин обладает активностью в отношении G. lamblia , но в целом активность ниже, чем у нитроимидазолов, хинакрина или фуразолидона 30, 101. Однако из-за плохой кишечной абсорбции он компенсирует его низкая противопротозойная активность за счет достижения высокого уровня в кишечнике. В модели на крысах препарат показал эффективность 15.

Клинические исследования ограничены, терапевтическая эффективность колеблется от 55 до почти 90% (таблица) 47, 63, 140, 191, 218.Обычная доза составляет 500 мг три раза в день в течение 10 дней для взрослых и 25-30 мг/кг/день (разделенная на три приема) для детей (таблица).

Как и другие аминогликозиды, при системном всасывании паромомицин может вызывать ототоксичность и нефротоксичность. Однако он может быть менее ототоксичен, чем другие аминогликозиды 142, и при ограниченной системной абсорбции токсичность не должна вызывать беспокойства у людей с нормальными почками. Тем не менее, его следует использовать с осторожностью у пациентов с нарушением функции почек.

Бацитрацин цинк.

Поиск альтернативных эффективных препаратов против Giardia привел исследователей к рассмотрению вопроса о бацитрацине. Бацитрацин был впервые выделен в 1945 г. из штамма Bacillus и применялся системно против тяжелых стафилококковых инфекций до 1960 г., когда его токсичность и доступность других антибиотиков ограничили его главным образом местным применением. стабильность. Бацитрацин оказывает свое действие на бактерии, препятствуя стадии дефосфорилирования в синтезе клеточной мембраны.После продемонстрированной in vitro эффективности против E. histolytica и Trichomonas , бацитрацин цинка был протестирован in vitro против Giardia и оказался активным 12, 13.

Клиническое исследование, проведенное Andrews et al. использовали два раза в день в течение 10 дней и сравнили эффективность 120 000 ЕД бацитрацина цинка, 120 000 ЕД бацитрацина, 120 000 ЕД неомицина и 60 000 ЕД бацитрацина цинка в сочетании с 60 000 ЕД неомицина 14. Частота излечения 95% для бацитрацин цинка, 88% для бацитрацина или комбинации бацитрацин цинк-неомицин и 86% для неомицина.Побочные эффекты были ограничены небольшим числом пациентов, которые испытывали диарею, дискомфорт в животе, запор и тошноту. Из исследования исключались дети младше 10 лет.

Недостатки использования бацитрацина цинка включают возможность нефротоксичности при длительном пероральном приеме и желудочно-кишечные расстройства. Кроме того, на соблюдение может повлиять 10-дневный период дозирования, а составы, используемые Эндрюсом в их исследовании, недоступны. Хотя бацитрацин цинка является многообещающим, необходимы дополнительные исследования, прежде чем он сможет получить широкое признание в качестве агента против G.лямблии .

Новые и экспериментальные терапевтические средства.

Широкий спектр химиотерапевтических агентов, включая рифампицин, битионол, дихлорофен, гексахлорофен, пириметамин, фузидат натрия, хлорохин и мефлохин, продемонстрировал активность in vitro в отношении Giardia 81, 84, 233. Липофильные тетрациклины, такие как доксициклин, сильно активен in vitro; однако их клиническая эффективность ограничена, возможно, из-за их быстрой абсорбции из кишечника 70.Некоторые аналоги пентамидина, а также азитромицин обладают активностью in vitro, сравнимой с активностью метронидазола 25, 33.

Нитазоксанид, производное 5-нитротиазола с широким спектром активности против простейших, гельминтов и некоторых бактерий, показал ограниченную эффективность у взрослых. и у детей в Мексике (эффективность 71% [213] и 78% [211] соответственно) и у нескольких больных СПИДом в Мали 64. Его назначали в дозе от 100 до 500 мг два раза в день в течение 3-7 дней.

Исследования на крысиной модели продемонстрировали эффективность ивермектина в определенных условиях 260.Дисульфирам, активное цинковое соединение, используемое для лечения алкоголизма у людей, демонстрирует значительную эффективность лечения и снижение паразитарной нагрузки на мышиной модели лямблиоза 180.

у племен луо в Восточной Африке метанольные экстракты 21 из 36 исследованных таксонов были летальными или подавляли рост G. lamblia in vitro 124. Экстракты Geranium nivem также показали активность in vitro 45.Иммуномодулирующий растительный препарат Pippali rasayana , часто назначаемый для лечения гельминтозов и хронической дизентерии в Индии, достиг 98% излечения мышиной инфекции с помощью G. lamblia 6. Экстракты плодов Piper longum были эффективны при мышиная модель инфекции 241.

Proposlina, препарат пчелиного клея, продемонстрировал 60% уровень паразитологического излечения через 1 неделю после завершения лечения среди 48 взрослых на Кубе 172, 261. У пациента с резистентной к метронидазолу инфекции Giardia Антагонист β-адренорецепторов dl-пропранолол, назначаемый в дозе 40 мг три раза в день с метронидазолом по 400 мг три раза в день в течение 10 дней, излечил инфекцию, продемонстрировав клиническую эффективность у людей 197.Исследования in vitro демонстрируют, что пропранолол оказывает свое действие, подавляя подвижность и рост простейших, скорее всего, благодаря мембраностабилизирующей активности препарата 85. Однако необходимы дальнейшие исследования dl-пропранолола и родственного соединения d-пропранолола. прежде чем их можно будет рекомендовать в качестве средств против Giardia .

Иммунопрофилактические стратегии для предотвращения или лечения лямблиоза, как правило, не были эффективными 87. Пассивный перенос иммунной сыворотки против Giardia не способствовал элиминации паразитов при лямблиозе мышей 76, 242.Несмотря на то, что пациенты с общим вариабельным иммунодефицитом имеют симптоматическую и длительную инфекцию Giardia , противопаразитарная терапия необходима для контроля их инфекции 106, 216. липазы, стимулируемой солями желчных кислот 204. Кроме того, грудное вскармливание может оказывать некоторую защиту грудным детям 176, 183; однако метод введения энтеральных антител против Giardia не изучался.

Особые ситуации

Беременность и кормление грудью.

Ведение симптоматической инфекции G. lamblia во время беременности является сложной задачей для клинициста, поскольку ни один терапевтический агент не сочетает в себе оптимальную эффективность и безопасность. Женщинам с бессимптомным течением, легкой формой заболевания или в первом триместре обычно следует избегать лечения. Однако женщинам, у которых невозможно поддерживать адекватную гидратацию и нутриционный статус, следует проводить лечение даже в первом триместре.

Метронидазол, который быстро попадает в кровоток плода после поглощения матерью, продемонстрировал мутагенность в отношении бактерий и канцерогенность в отношении мышей и крыс 34, 36, 153, 240, 251. Хотя эта информация вызывает обеспокоенность по поводу использования препарата во время беременности , канцерогенность не была продемонстрирована у людей 23, 24, 78, 98, 212, а также не было тератогенности у грызунов 164a. Метронидазол широко применялся во время беременности (категория беременности В), прежде всего для лечения трихомониаза курсами от 7 до 10 дней [42].Результаты относительно безопасности для плода противоречивы 36, 42, 107, 212, 215, 218. В одном ретроспективном исследовании 1469 женщин, принимавших метронидазол во время беременности, 206 из которых принимали препарат в первом триместре, не было обнаружено признаков врожденных аномалий 26. Тем не менее, Совместный перинатальный проект, включавший более 50 000 пар мать-ребенок, продемонстрировал, что воздействие метронидазола в первом триместре у 31 женщины показало возможную связь с пороками развития 107. Мета-анализ семи исследований, в которых проспективно наблюдали 253 пары мать-ребенок. и ретроспективный мониторинг 1083 пар не выявил повышенного риска пороков развития плода в связи с использованием метронидазола в первом триместре 42, при этом в одном отчете относительный риск оценивается как 0.92 для врожденных дефектов 215. В целом, может быть несколько повышенный риск при использовании метронидазола в течение первого триместра, поэтому его следует избегать в этот период. Короткие курсы высоких доз (≥2,0 г) не следует назначать во время беременности.

Метронидазол активно выделяется с грудным молоком в концентрациях, сходных с таковыми в плазме. Американская академия педиатрии (AAP) рекомендует однократно давать 2 г кормящим матерям с последующим прекращением кормления на 12–24 ч [10, 36].ААР также рекомендует матерям, принимающим тинидазол, прекратить кормление грудью на тот же период времени, что и тем, кто принимает метронидазол 10. Однако метронидазол одобрен для использования у детей для лечения амебиаза и используется у детей для лечения анаэробных инфекций, поэтому может показаться, что небольшое количество, выделяемое в грудное молоко, не будет вредным. Кроме того, поскольку однократные схемы метронидазола с высокими дозами имеют низкую эффективность и, как ожидается, приведут к более высоким уровням в грудном молоке, эти данные свидетельствуют в пользу традиционного лечения более низкими дозами в течение 5–7 дней.

Паромомицин обычно считается безопасным, поскольку он плохо всасывается из кишечника и почти на 100% выводится с калом в неизмененном виде. Поэтому мало, если вообще какое-либо лекарство достигнет плода. Однако он не так эффективен, как метронидазол или акрихин. Кроме того, никакие клинические испытания не изучали влияние высоких концентраций паромомицина в сыворотке крови во время беременности. Тем не менее, паромомицин успешно применялся для эрадикации инфекции G. lamblia у беременных женщин и является важным средством, которое следует рассмотреть в течение первого триместра, когда не следует использовать метронидазол 140, 218.Паромомицин также должен быть безопасным для кормящих матерей. Исследование на овцах показало, что скорость выделения препарата в грудном молоке составляет всего 0,018% в течение 12 часов после парентерального введения 36, 263. ААП определяет, что стрептомицин и канамицин, аминогликозидные родственники паромомицина, совместимы с грудным вскармливанием 10.

Один эксперт по лямблиозу поддержал лечение беременных хинакрином из-за его высокой степени излечения 256. Хотя препарат очень эффективен, его медленное выведение из организма и доказанная тератогенность на крысах делают его неоптимальным выбором для лечения беременных.Хотя хинидин и хинин совместимы с грудным вскармливанием, информации о безопасности хинакрина для детей, находящихся на грудном вскармливании, не имеется 10.

Фуразолидон не рекомендуется беременным. Хотя он эффективен, он вызывает опухоли молочных желез у мышей и мутации бактерий, что должно удерживать врачей от его использования в этих условиях 164b. Его безопасность для детей, находящихся на грудном вскармливании, неизвестна. Альбендазол считается препаратом категории С при беременности и оказывает тератогенное действие на крыс и кроликов, хотя опыт его воздействия на беременных женщин невелик.

Бессимптомная инфекция.

В глобальном масштабе у большинства людей, инфицированных G. lamblia , заболевание протекает бессимптомно или с минимальными симптомами. Лечение бессимптомных пациентов, особенно детей, является спорным вопросом, и перед началом терапии необходимо учитывать несколько факторов. Обстановка инфекции играет ключевую роль в принятии решения. В районах, где G. lamblia является эндемичным, лечение может быть нежелательным, поскольку после лечения дети могут быстро заразиться повторно 96, 231.Если Giardia способствует отсутствию роста и развития 86, 163, 227, лечение, даже если может произойти повторное заражение, может обеспечить догоняющий рост 103 и может стоить затрат и усилий. В этих условиях может быть полезен такой препарат, как альбендазол, который также лечит нематодные инфекции; однако требование 5-дневного дозирования затруднило бы завершение терапии во многих ситуациях.

В условиях, при которых базовый уровень питания ребенка превосходен, например, в детских садах в развитых странах, бессимптомным носителям может не всегда потребоваться терапия 5, 121, 195, 203, 221, 237.Однако следует отметить, что бессимптомно инфицированные дети могут выделять Giardia в течение 195 месяцев, нести его домой членам семьи и, таким образом, инициировать заражение в домашнем хозяйстве и даже способствовать поддержанию высокого уровня инфекции Giardia в сообществе 4, 196, 224; GD Overturf, Editorial, Clin. Заразить. Дис. 18: 764–765, 1994). Нередко у матери маленького ребенка, находящегося в дневном стационаре, появляются симптомы лямблиоза, определяя наличие в домашнем хозяйстве Giardia , который был занесен бессимптомным ребенком.При рецидивирующей диарее, связанной с Giardia , в дневном стационаре, которую нельзя контролировать с помощью улучшения гигиены, лечения и исключения детей с симптомами, можно рассмотреть вопрос о скрининге и лечении всех детей в дневном стационаре 5, 18. , 230.

При обнаружении Giardia в стуле и маловероятности повторного заражения, например, у вернувшегося путешественника, можно назначить лечение. В домашнем хозяйстве, если у одного члена есть симптомы и существует вероятность фекально-орального распространения внутри семьи или наличия общего источника инфекции, все члены семьи должны пройти обследование и лечение, чтобы не произошло повторного заражения.

Другим фактором, который следует учитывать при принятии решения о лечении бессимптомных носителей, являются последствия передачи инфекции, если носитель не лечится, например, заражение работников пищевых продуктов 169, 199. Эту группу следует лечить, чтобы предотвратить вспышки пищевого происхождения.

Резистентность и рецидив.

Сообщалось о неэффективности лечения всеми распространенными препаратами против Giardia , включая метронидазол, хинакрин, фуразолидон и альбендазол. Тем не менее, для клинициста, сталкивающегося с рецидивом симптомов после терапии, важно различать действительную лекарственную устойчивость, излечение с последующим повторным инфицированием и пост- Giardia непереносимость лактозы.Таким образом, первым шагом является документирование истинной персистирующей инфекции путем отправки образца стула на исследование O&P или обнаружение антигена Giardia . Если проба положительна, тщательный анамнез контакта должен предоставить информацию о вероятности повторного заражения, а повторно инфицированные лица должны реагировать на первоначальное терапевтическое средство. Повторное заражение будет обычным явлением в эндемичных регионах по всему миру и в условиях плохой фекально-оральной гигиены. Если у пациента произошло повторное инфицирование, следует выявить факторы риска и проконсультировать пациента относительно правильных мер гигиены и профилактики.

Непереносимость лактозы после введения Giardia является наиболее частым дефицитом дисахаридазы, связанным с лямблиозом, и может возникать у 20–40% пациентов 65. должны быть установлены продукты питания и жидкости. Этот синдром может занять несколько недель, чтобы решить.

Истинная неудача лечения может означать заражение лекарственно-устойчивым изолятом Giardia . Резистентность к большинству агентов против Giardia была задокументирована или индуцирована in vitro 29, 154, 245–247, а также к множеству генотипически различных клонов G.lamblia с чувствительностью к различным классам препаратов были обнаружены в двенадцатиперстной кишке человека 46, 81, 160, 248. Однако не было выявлено последовательной корреляции между резистентностью или чувствительностью in vitro и клинической неудачей или успехом 43, 160, 164, 225, 249, по-прежнему оставляя открытым вопрос об истинной резистентности к паразитам.

Клинически резистентные штаммы лечили более длительными повторными курсами или более высокими дозами исходного агента 91, 165, 178. Однако наиболее эффективным средством искоренения этих инфекций, по-видимому, является использование препарата другого класса, чтобы избежать потенциального перекрестного заражения. сопротивление 52, 92.Первоначальный переход на препарат другого класса не всегда может быть эффективным, как это было продемонстрировано у двух французских пациентов, у которых лечение альбендазолом было неудачным после двух курсов метронидазола, но был ответ на хинакрин (P. Brasseur and L. Favennec, Letter, Parasite 2: 422, 1995). Комбинированные режимы с использованием метронидазола-альбендазола, метронидазола-хинакрина или других активных препаратов или назначение нитроимидазола плюс хинакрина курсом не менее 2 недель доказали свою эффективность при рефрактерной инфекции 44, 182a, 197, 225, 234.Иногда для эффективного лечения потребуются несколько различных комбинаций или подходов.

В случаях лямблиоза, при котором альтернативная терапия неэффективна, следует рассмотреть другие возможности, например наличие иммунологической недостаточности. Хронический лямблиоз у пациентов с гипогаммаглобулинемией хорошо регистрируется 106, 108, 216 и может быть трудно поддающимся лечению, часто требующим длительных курсов терапии. Хотя Giardia наблюдается у гомосексуальных мужчин, занимающихся орально-анальной сексуальной практикой 162, 200, 226, болезнь часто может быть ни тяжелой, ни продолжительной 148.Тем не менее, у больных СПИДом с тяжелым лямблиозом может потребоваться пролонгированная или комбинированная терапия 182a.

Лечение лямблиоза

При оценке клинической эффективности средств, используемых против Giardia , трудно сравнивать исследования. Они различаются по методологии включения (была ли проведена рандомизация и было ли лечение слепым или открытым), изучаемой популяции (дети, взрослые, симптоматические и/или бессимптомные пациенты), показателям результатов (клиническая эффективность и/или отрицательный анализ стула) и продолжительности лечения. следовать за.Тем не менее, если рассматривать исследования в целом, можно сделать выводы и сделать выводы об относительной эффективности препаратов.

Классы агентов и клинические свойства

Нитроимидазолы.

Класс нитроимидазолов, используемых для лечения инфекции G. lamblia , включает метронидазол, тинидазол, орнидазол и секнидазол. Этот класс был открыт в 1955 году, и было обнаружено, что он очень эффективен против нескольких протозойных инфекций 240.Метронидазол [1-(β-гидроксиэтил)-2-метил-5-нитроимидазол; Flagyl] был определен как терапевтический против Trichomonas vaginalis и Entamoeba histolytica после его открытия в конце 1950-х годов 67, а в 1962 году Darbon et al. сообщили, что его можно использовать для лечения лямблиоза 57. С момента этого открытия клиницисты использовали метронидазол и другие нитроимидазолы в качестве основы для лечения лямблиоза.

Из нитроимидазолов наиболее тщательно изучен механизм уничтожения Giardia метронидазолом.Метронидазол использует анаэробные метаболические пути, присутствующие в Giardia . Лекарство попадает в трофозоит, и как только он оказывается внутри клетки, электронтранспортные белки ферредоксины от паразита отдают электроны нитрогруппе лекарства 223, 238, 244. Лекарство «активируется» путем восстановления этой нитрогруппы 223, 238, 240, и с помощью этой восстановительной реакции устанавливается градиент, способствующий внутриклеточному транспорту метронидазола. Восстановленный метронидазол служит терминальным акцептором электронов, который ковалентно связывается с макромолекулами ДНК 72, 177.Это приводит к повреждению ДНК в виде потери спиральной структуры, нарушения функции матрицы и обрыва цепи с последующей гибелью трофозоитов 95. В дополнение к этому эффекту метронидазол ингибирует дыхание трофозоитов 81, 189. Восстановительная активация метронидазола также может к токсическим радикалам, которые реагируют с основными клеточными компонентами 244. Трофозоиты внутри кист могут быть менее подвержены влиянию нитроимидазолов, возможно, из-за плохого проникновения лекарства через стенку кисты 236.Резистентность к метронидазолу индуцируется in vitro 29. Это коррелирует со снижением активности пируват:ферредоксин оксидоредуктазы паразита, которая необходима для восстановительной активации нитроимидазолов 239, 247.

Метронидазол быстро и полностью всасывается после перорального приема и проникает в ткани организма и выделения, такие как слюна, грудное молоко, сперма и вагинальные выделения 240. Препарат метаболизируется в основном в печени и выводится с мочой 147.

Анализы in vitro на чувствительность к нитроимидазолу проводились с G.lamblia с 1980 г. 112. Используя микроскопическую оценку морфологии и подвижности паразита, Jokipii и Jokipii впервые продемонстрировали эффективность метронидазола и тинидазола 129. Впоследствии морфология 13, 166, 175, ингибирование роста 56, 69, 94, 116, 160, 225 , [ 3 H] тимидина 32, 117, 164, уничтожение сыворотки 114, исключение витального красителя 114, 235, ингибирование прилипания 21, 55, 79, 166, 192, метаболический 228 и колориметрический 133 анализы. для измерения in vitro реакции препарата на многие терапевтические агенты.Однако, как показывает разнообразие используемых анализов, не существует стандарта для тестирования in vitro, что затрудняет сравнение результатов и применение результатов in vitro в клинических условиях.

Из нитроимидазолов тинидазол и метронидазол постоянно демонстрируют наибольшую активность in vitro; тинидазол обладает небольшим преимуществом 30, 32, 55, 101. Более высокозамещенные нитроимидазолы, такие как миконазол, клотримазол, итраконазол и кетоконазол, были разработаны из-за их противогрибковой активности и не являются эффективными средствами против G.lamblia 55. Чувствительность к нитроимидазолам может варьироваться в зависимости от штаммов и клонов G. lamblia , используемых в тестировании 29, 31, 79, 160.

В США метронидазол является единственным представителем класса нитроимидазолов, доступным для лечить лямблиоз; это также наиболее распространенный препарат, используемый для лечения во всем мире. Несмотря на его широкое и общепринятое использование против Giardia , Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США никогда не одобряло его для этого показания. В клинических испытаниях применяли дозирование два и три раза в день (обычно 250 мг/доза) в течение 5–10 дней и короткий курс (1–3 дня), однократную ежедневную терапию (2.0 или 2,4 г/доза) 261. При 5-10-дневном режиме лечения эффективность колеблется от 60 до 100 % у взрослых и детей, при этом медиана эффективности в обеих группах составляет 92 % (таблица) 20, 49, 68. , 91, 92, 100, 127, 132, 135, 150, 151, 191, 201, 202, 232, 256. В целом этот график хорошо переносится, с большинством побочных эффектов, связанных с желудочно-кишечными расстройствами и металлическим привкусом (таблица).

Таблица 1

Таблица 1

Эффективность препаратов Анти- Гиардиа У взрослой и детской инфекции A

–2,4 г, разовая доза

9009 0 1

Таблица 2

Таблица 2

Рекомендуемое дозирование и неблагоприятное воздействие анти- Гиардиа препараты

Препарат
Препарат Доза B Средняя эффективность (%) C Диапазон эффективности (%) )
Метронидазол 500–750 мг/день × 5–10 дней 88 60–95 7 2 0059
48 36–60
2,0–2,4 г, 4 раза в сутки × 2 дня 71 67–80
2,0–2,4 г, 4 раза в сутки. × 3 дня 93-100 93-100
15-22,5 мг / кг / день × 5-10 дней D 94
Tinidazole 300 мг / день × 7 дней 87 74–100
1.0-2,0 г, одна доза 92 86-100 86-100
50 мг / кг, одиночная доза D 91 91 80-96
Орнидазол 1.0-2,0 г , Одноместный доза 96-100
40-50 мг / кг, одна доза D 92-100
Secnidazole 2,0 г, одна доза 86-100
30 мг / кг, 1 или 2 дозы D 88-100 88-100
Quinacrine 300 мг / день × 5-7 дней 95 -100
6-8 мг / кг / день × 5-10 дней D 92-95 92-95
Furazolidone 400 мг / день × 7-10 дней 80–85
8 мг/кг/ День × 7-10 дней D 92 81-96 81-96
albendazole 200-800 мг / день × 1-3 дня 24-81
200- 400 мг / день × 5-7 дней 94-100 94-100
Paromomycin
10-50 мг / кг / день или 1500 мг / день × 5-10 дней 55-88
Бацитрацин цинка 240 000 u / день × 10 дней 95
95
B
препарат Взрослый доза f Детская доза Побочные эффекты
Метронидазол a 250 мг t.я бы. × 5–7 дней 5 мг/кг 3 раза в день × 5-7 дней головная боль, Vertigo, тошнота, металлический вкус, urticaria
дисульфирам-подобной реакции с алкоголем 10070
редкий: панкреатит, центральный нервный системная токсичность, обратимая нейтропения, периферическая нейтропатия, уплощение зубца Т при длительном применении
Мутагенный/канцерогенный?
Tinidazole B 2 г, одна доза 50 мг / кг, одна доза (макс, 2 г) как для Metronidazole
Ornidazole C 2 г, одна доза 40–50 мг/кг, разовая доза (макс. 2 г) То же, что и метронидазол
Хинакрин c 100 мг t.я бы. × 5–7 дней 2 мг/кг 3 раза в день × 7 дней тошнота и рвота, головокружение, головная боль
редко: токсичный психоз
Furazolidone д 100 мг четыре раза в день × 7–10 дней 2 мг/кг 4 раза в день × 10 дней Тошнота, рвота, диарея
Коричневое окрашивание мочи; дисульфиры-подобная реакция с употреблением алкоголя
реагирует неблагоприятно с ингибиторами МАО
Мягкого гемолиза при дефиците G6PDH
Канцерогенных?
Паромомицин a 500 мг t.я бы. × 5–10 дней 30 мг/кг/день в 3 приема × 5–10 дней Ототоксичность и нефротоксичность при системном введении
Альбендазол a 400 мг 4 раза в сутки × 5 дней 15 мг / кг / день × 5-7 дней (макс, 400 мг) анорексия, запор
редко: обратимые нейтропения и повышенные функции печени
Тератогенный?
Бацитрацин цинк e 120 000 U b.я бы. × 10 дней не проверено у детей до 10 лет тошнота, рвота, брюшной дискомфорт
нефротоксичность с системным поглощением

Одно доза, краткосрочные процедуры высокая доза ежедневно) были разработаны для улучшения соблюдения режима лечения без ущерба для эффективности. Их применяли как у взрослых, так и у детей. Эти схемы, как правило, менее эффективны, особенно если вводится только одна доза метронидазола.Эффективность однократной терапии колеблется от 36 до 60% при назначении препарата в течение 1 дня 16, 93, 127, 130, 220, 229 и повышается до 67–80% при назначении препарата в течение 2 дней (табл. ). 127, 130, 146; Э. Грин, Д. М. Линч, Дж. А. Макфадзин и И. М. Пью, Письмо, Бр. Мед. J. 2: 411–412, 1974). Продолжение однократной дозы в течение 3 дней увеличивает эффективность до уровня, наблюдаемого при более низких дозах и более длительном курсе терапии 229; Грин и др., письмо). Схемы с высокими дозами также могут иметь больше побочных эффектов 127.

Дети были включены во многие испытания как длительного, так и короткого курса терапии, с результатами, аналогичными таковым у взрослых, и эффективностью от 80 до 100% (медиана 94%) при 5-10-дневных схемах лечения 91 , 100, 132, 135, 186, 201, 232; А. Растегар-Лари и А. Салек-Могхаддам, Письмо, J. Trop. Педиатр. 42: 184–185, 1996). Хотя метронидазол не выпускается в стандартной жидкой форме, суспензию можно приготовить путем тщательного измельчения таблеток метронидазола, использования капли глицерина в качестве смазки и суспендирования смеси в вишневом сиропе NF 150.

Наиболее частые побочные эффекты лечения метронидазолом включают головную боль, головокружение, тошноту и металлический привкус во рту (таблица). Тошнота возникает у 5-15% пациентов, получающих стандартные многодневные курсы [135, 151]. Кроме того, метронидазолу приписываются панкреатит, токсическое действие на центральную нервную систему [144, 212] и транзиторная обратимая нейтропения [147]. избегайте употребления алкоголя при приеме метронидазола. Ингибирование альдегиддегидрогеназы метронидазолом может вызвать сильную рвоту, приливы, головную боль и желудочно-кишечные боли после приема алкоголя.

Метронидазол оказывает мутагенное действие на бактерии и канцерогенное действие на мышей и крыс в высоких дозах в течение длительного времени 34, 153, 240, 251. Однако мутагенность у людей никогда не регистрировалась, что позволяет предположить, что использование метронидазола в этом отношении безопасно 23, 78, 98, 212. Это может, однако, смягчить воздействие коротких курсов высоких доз у детей.

Обнаружение терапевтической эффективности метронидазола побудило исследователей разработать и испытать другие производные нитроимидазола.Другие препараты, тинидазол, орнидазол и секнидазол, имеют более длительный период полувыведения, что делает их подходящими для однократной терапии суточными дозами 217. Одна доза тинидазола (Фазигин) была успешно использована в 1971 г. в группе шведских студентов, заболевших лямблиозом. во время визита в Россию 11. Эта однократная доза 2 г (или эквивалент для детей) последовательно доказывала клиническую эффективность от 80 до 100% со средней эффективностью 92% (таблица) 16, 126, 130, 131 , 146, 151, 193, 222, 229, 261; З. Фарид, Н.A. El Masry, W. F. Miner и A. Hassan, Letter, Lancet ii: 721, 1974; Т. Петтерссон, Письмо, Бр. Мед. J. 1: 395, 1975) и намного превосходит метронидазол при прямом сравнении режимов однократной дозы 93, 130, 229, 261. Также наблюдается улучшенное соблюдение этой схемы дозирования. Рекомендуемая доза для детей обычно составляет 50 мг/кг для однократной дозы (таблица) 82, 193, 232, 256, и препарат доступен в виде жидкой суспензии.

Побочные эффекты тинидазола встречаются не так часто, как метронидазол, но включают горечь, головокружение и желудочно-кишечные расстройства (таблица) 130, 131; Петтерссон, письмо).Тинидазол недоступен в Соединенных Штатах, но поставщики медицинских услуг рекомендуют некоторым путешественникам, особенно путешествующим в течение длительного времени или путешествующим по суше в Азии, приобрести препарат по прибытии в страну назначения и принимать его в случае заражения лямблиозом 113.

Другим производным нитроимидазола, которое также недоступно в США, является орнидазол. Было проведено меньше исследований с орнидазолом, но он обладает превосходной эффективностью при приеме в течение нескольких дней и эффективностью, аналогичной тинидазолу (от 92 до 100%), при однократном приеме 19, 131, 145, 220, 232, 261.Однократная доза орнидазола (40 мг/кг) также назначалась детям с очевидными преимуществами в отношении соблюдения режима и стоимости [39, 186]. рутинное использование этого препарата у детей до завершения широкомасштабных исследований рецидивов, канцерогенности и побочных эффектов 39.

Секнидазол, производное 5-нитроимидазола длительного действия, использовался, но недоступен в США.Подобно тинидазолу и орнидазолу, секнидазол обычно назначают однократно. Наиболее распространенная схема составляет 2 г для взрослых и 30 мг/кг для детей 95. Клинические исследования демонстрируют уровень эффективности более 85% при однократном приеме у взрослых 49; Р. Бакай, Х. Куреши и С. Дж. Зубери; Письмо, Дж. Пак. Мед. доц. 45:288, 1995), а у детей эта доза так же эффективна, как 7-10-дневный курс метронидазола 100; Растегар-Лари и Салек-Могаддам, Письмо). Препарат быстро и полностью всасывается, имеет период полувыведения от 17 до 29 часов и метаболизируется путем окисления в печени 95.Сообщалось о побочных эффектах, в первую очередь желудочно-кишечных расстройствах (тошноте, анорексии и боли в животе) и головокружении, но обычно не требующих отмены препарата.

Квинакрин.

Хинакрин (атабрин) был впервые представлен в качестве противомалярийного средства в 1930 году после работы Кикута и стал предпочтительным противомалярийным средством для союзных войск во время Второй мировой войны из-за его большей доступности и лучшей переносимости по сравнению с хинином 240. После войны, вскоре он стал важным агентом против G.lamblia с клинической эффективностью 90% и более 20, 52, 105, 255. Однако, поскольку рынок США ограничен лечением Giardia , использование хинакрина сократилось, и его производство в США было прекращено. в 1992 г., хотя его все еще можно получить из альтернативных источников (таблица).

Противопротозойный механизм хинакрина до конца не выяснен. Препарат легко встраивается в ДНК G. lamblia , и считается, что именно это взаимодействие вызывает ингибирование синтеза нуклеиновых кислот 240.Различная относительная скорость поглощения хинакрина между человеческими и клетками G. lamblia может быть причиной селективной токсичности препарата 236. In vitro хинакрин снижает жизнеспособность цист и скорость их эксцистации 179, 189. Резистентность индуцируется in vitro, а в в одном исследовании это коррелировало со снижением усвоения препарата 246. Квинакрин быстро всасывается из кишечного тракта и широко распределяется в тканях организма.

Хотя результаты различаются в зависимости от используемого теста чувствительности in vitro, было показано, что метронидазол и фуразолидон немного более эффективны, чем хинакрин 30, 32, 55, 94.Однако в других исследованиях in vitro эффективность хинакрина и метронидазола одинакова 21, 117, 164. Некоторые из этих различий могут быть связаны с большей вариабельностью чувствительности к хинакрину, чем к метронидазолу или фуразолидону между клонами Giardia 31.

Клинически хинакрин очень эффективен: исследования показали, что его эффективность в течение 5-10 дней составляет около 95% (таблица) 20, 135, 220, 255. Некоторые исследователи считают этот препарат наиболее эффективным из всех анти- Giardia терапевтические средства 256.Дозировка обычно составляет 100 мг три раза в день в течение 5–7 дней для взрослых и 6 мг/кг/день в три приема в течение 5–7 дней для детей (таблица) 150.

Побочные эффекты не позволяют многим врачам использовать хинакрин. , особенно у детей (таблица). Горький вкус наряду с рвотой отмечался у 28% участников исследования 20, 52 и приводил к более низкой эффективности у детей младше 5 лет 52, вероятно, из-за низкой приверженности лечению. Желто-оранжевое обесцвечивание кожи, склер и мочи наблюдается у 4-5% пациентов, принимающих хинакрин, начиная примерно через 1 неделю после начала лечения и может сохраняться до 4 месяцев после прекращения терапии.Другие распространенные побочные эффекты включают тошноту, рвоту, головную боль и головокружение 254. Лекарственный психоз встречается редко, а эксфолиативный дерматит и ретинопатия, вызванная хинакрином, встречаются редко 82. Хинакрин может усугублять псориаз, а глюкозо-6-фосфатдегидрогеназа (Г6ФДГ) может усугублять течение псориаза. -дефицитные люди, это может вызвать гемолиз. Противопоказан при беременности из-за возможной связи с расщеплением позвоночника и агенезией почек. Никогда не было доказано, что он канцерогенен, хотя он имеет механизм действия связывания с ДНК.

Фуразолидон.

Фуразолидон (фуроксон) является одним из тысяч нитрофурановых соединений, созданных с момента открытия этого класса в 1940-х годах143. Он эффективен против многих бактерий, включая Klebsiella spp., Clostridium spp., Escherichia coli , , Campylobacter spp. и Staphylococcus aureus . Еще в 1950-х годах фуразолидон использовался для лечения лямблиоза 253. Он одобрен для использования в Соединенных Штатах и ​​остается важным терапевтическим средством во всем мире.Из распространенных терапевтических средств против Giardia это единственное, доступное в США в виде жидкой суспензии; поэтому его использование было рекомендовано в педиатрической популяции 150.

Механизм действия фуразолидона против G. lamblia , как и многих противопаразитарных средств, полностью не объяснен. Препарат подвергается восстановительной активации в трофозоите G. lamblia , но, в отличие от метронидазола, восстановление, возможно, происходит с помощью НАДН-оксидазы 38, 244.Его убивающий эффект коррелирует с токсичностью восстановленных продуктов, которые могут повредить важные клеточные компоненты, включая ДНК. Резистентность к фуразолидону может быть связана с уменьшением проникновения лекарственного средства 246 или с повышенным уровнем тиол-циклирующих ферментов, которые могут защищать от токсичных радикалов 249. Лекарственное средство легко всасывается через желудочно-кишечный тракт и быстро метаболизируется в тканях, что приводит к низким концентрациям в сыворотке и моче 143.

В тестах на чувствительность in vitro фуразолидон действует сравнимо с метронидазолом и постоянно демонстрирует самую высокую активность среди неимидазолов 32, 55, 101; он более активен, чем хинакрин 30.

Клинические исследования с использованием фуразолидона многочисленны и были завершены с широким кругом субъектов, доз и графиков введения. Хотя его эффективность обычно считается несколько ниже, чем у метронидазола и хинакрина, сообщалось о показателях излечения от 80 до 96% при 7-10-дневных курсах (таблица) 20, 52, 91, 151, 178, 191. , 201, 255. Когда препарат принимается всего 5 дней, его эффективность значительно падает 151, 178. Его назначают в виде четырех доз в день как взрослым (100 мг на дозу), так и детям (1.5 мг/кг) (таблица). В педиатрической суспензии две столовые ложки заменяют таблетку по 100 мг.

Около 10% пациентов сообщают о желудочно-кишечных симптомах, таких как тошнота, рвота и диарея (таблица ) 150, 256. Другие побочные эффекты могут включать изменение цвета мочи на коричневый; гемолиз может возникать у пациентов с дефицитом G6PDH. Препарат оказывает ингибирующее действие на моноаминоксидазу (МАО), и его никогда не следует назначать одновременно лицам, уже принимающим ингибиторы МАО. Были редкие сообщения о дисульфирамоподобных реакциях при приеме с алкоголем 164b.Сообщалось о маниакальном эпизоде, вызванном фуразолидоном, у пациента, инфицированного вирусом иммунодефицита человека 73. Фуразолидон также противопоказан детям в возрасте до 1 месяца, у которых может развиться гемолитическая анемия из-за обычно нестабильного глутатиона. Наконец, препарат оказывает мутагенное действие на бактерии и, как было показано, вызывает опухоли молочных желез у крыс и опухоли легких у мышей при длительном приеме в высоких дозах. Однако значение этого открытия для человека неизвестно и не было адекватно рассмотрено 143, 164b, 236.При лечении детей преимущества минимальных побочных эффектов и доступности жидкой суспензии необходимо сопоставлять с необходимостью частого введения в течение 10-дневного периода лечения.

Бензимидазолы.

Два представителя класса бензимидазолов, альбендазол (Albenza) и мебендазол (Vermox), использовались для лечения инфекции G. lamblia 155. Клинические исследования и исследования эффективности in vitro дали разные результаты в отношении их эффективности.Однако сравнительно мягкий профиль побочных эффектов в сочетании с доказанной эффективностью против многих гельминтов делает их перспективными для лечения 208, 250. -тубулиновый цитоскелет 71, 175, 209. Это связывание вызывает как ингибирование полимеризации цитоскелета, так и нарушение захвата глюкозы 250. Хотя точное место связывания на цитоскелете не определено, постулируется, что взаимодействие бензимидазол-колхицин может играть определенную роль. 51, 166, 236.Бензимидазолы плохо всасываются из желудочно-кишечного тракта, хотя это можно улучшить при одновременном приеме жирной пищи. Системный эффект альбендазола обусловлен его первичным метаболитом, альбендазолсульфоксидом, который быстро образуется в печени после абсорбции 3. Выведение почками незначительно.

Тестирование in vitro чувствительности G. lamblia к бензимидазолам ограничено по сравнению с чувствительностью паразита к нитроимидазолам или хинакрину.Тем не менее, исследования демонстрируют значительный эффект in vitro 79, 175, 208, 209. В одном отчете показано, что и альбендазол, и мебендазол были в 30-50 раз более активны, чем метронидазол, и в 4-40 раз более активны, чем хинакрин in vitro 71. Другой продемонстрировал, что способность альбендазола влиять на морфологию, прилипание и жизнеспособность трофозоитов была намного выше, чем у метронидазола или тинидазола 166. Однако их переменная клиническая эффективность демонстрирует несоответствие между тестированием in vitro и активностью in vivo.Резистентность к альбендазолу может быть индуцирована in vitro 154 и коррелирует с изменениями в цитоскелете паразита 243. Другие бензимидазолы, такие как нокодазол, оксфендазол, тиабендазол и фенбендазол, также продемонстрировали некоторую эффективность in vitro 236.

Клинические испытания ограничивались альбендазолом и мебендазол со смешанными результатами. Холл и Нахар сообщили о равной лечебной эффективности альбендазола и метронидазола у детей, когда альбендазол назначался в течение 5 дней, но не при однократном или трехдневном приеме (таблица) 104.Снижение эффективности альбендазола при приеме в течение 3 дней или менее также было задокументировано Kollaritsch et al. у путешественников с лямблиозом 137, Pungpak et al. у детей и взрослых 198, и Pengsaa et al. у детей 193. Повышение эффективности наблюдалось у других пациентов, когда препарат назначался в течение 5 дней 171, 207, 214 или 7 дней 198. Исключение в отношении необходимости более длительных курсов лечения наблюдалось в одном исследовании, в котором вводилась однократная доза 68. Комбинация альбендазол-метронидазол была эффективна на 100% у 20 пациентов с резистентным к метронидазолу лямблиозом, у которых от трех до пяти курсов стандартной пероральной терапии метронидазолом не удавалось 44.

Лечение мебендазолом привело к сильно различающимся клиническим результатам. Al-Waili сообщил о более чем 90% эффективности в двух исследованиях у детей 8, 9. Однако другие исследования как у детей, так и у взрослых не показали одинакового успеха, но вместо этого показали эффективность у 80% 211 и у 60% или менее 39, 92 , 132; Л. ди Мартино, А. Ночерино и М. Петтоелло Мантовани, Письмо, пер. Р. Соц. Троп. Мед. Гиг. 85: 557–558, 1991), а также отсутствие снижения показателей распространенности Giardia при использовании мебендазола при массовом лечении гельминтов 219.Из-за этого несоответствия наибольший интерес был сосредоточен на альбендазоле.

Дозировка для взрослых обычно составляет 400 мг в день в течение 5 дней для альбендазола и 200–400 мг в день в течение 5–10 дней для мебендазола (таблица). Обычная доза для детей составляет 15 мг/кг в сутки в течение 5–7 дней. Оба препарата доступны в виде суспензии. Одним из преимуществ использования альбендазола у детей является его эффективность против многих гельминтов, что позволяет эффективно лечить множество кишечных паразитов 207, 208. Другим преимуществом является относительное отсутствие побочных эффектов.Однако при кратковременном употреблении он может вызвать желудочно-кишечные проблемы, такие как анорексия и запор. Длительное применение альбендазола в высоких дозах, например, при личиночных цестодных инфекциях, вызывает обратимую нейтропению и повышение уровня печеночных ферментов [3, 155, 258]. Альбендазол противопоказан при беременности из-за возможного тератогенного действия (категория беременности). C), но исследования на животных не показали увеличения канцерогенной заболеваемости.

Паромомицин.

Паромомицин (хуматин), член семейства аминогликозидов, был впервые выделен в 1956 году.Он показан для лечения Entamoeba histolytica и Trichomonas и был предложен для лечения G. lamblia при резистентных инфекциях и во время беременности 113, 140. Паромомицин плохо всасывается из просвета кишечника; даже при пероральном введении больших доз достигаются лишь минимальные концентрации в крови и моче пациентов с нормальной функцией почек 140. Паромомицин ингибирует синтез белка G. lamblia , вмешиваясь в 50S- и 30S-субъединицы рибосомы (рРНК паразита имеет необычный размер и последовательность) и вызывая неправильное прочтение кодонов мРНК 69.

Анализ чувствительности in vitro показывает, что паромомицин обладает активностью в отношении G. lamblia , но в целом активность ниже, чем у нитроимидазолов, хинакрина или фуразолидона 30, 101. Однако из-за плохой кишечной абсорбции он компенсирует его низкая противопротозойная активность за счет достижения высокого уровня в кишечнике. В модели на крысах препарат показал эффективность 15.

Клинические исследования ограничены, терапевтическая эффективность колеблется от 55 до почти 90% (таблица) 47, 63, 140, 191, 218.Обычная доза составляет 500 мг три раза в день в течение 10 дней для взрослых и 25-30 мг/кг/день (разделенная на три приема) для детей (таблица).

Как и другие аминогликозиды, при системном всасывании паромомицин может вызывать ототоксичность и нефротоксичность. Однако он может быть менее ототоксичен, чем другие аминогликозиды 142, и при ограниченной системной абсорбции токсичность не должна вызывать беспокойства у людей с нормальными почками. Тем не менее, его следует использовать с осторожностью у пациентов с нарушением функции почек.

Бацитрацин цинк.

Поиск альтернативных эффективных препаратов против Giardia привел исследователей к рассмотрению вопроса о бацитрацине. Бацитрацин был впервые выделен в 1945 г. из штамма Bacillus и применялся системно против тяжелых стафилококковых инфекций до 1960 г., когда его токсичность и доступность других антибиотиков ограничили его главным образом местным применением. стабильность. Бацитрацин оказывает свое действие на бактерии, препятствуя стадии дефосфорилирования в синтезе клеточной мембраны.После продемонстрированной in vitro эффективности против E. histolytica и Trichomonas , бацитрацин цинка был протестирован in vitro против Giardia и оказался активным 12, 13.

Клиническое исследование, проведенное Andrews et al. использовали два раза в день в течение 10 дней и сравнили эффективность 120 000 ЕД бацитрацина цинка, 120 000 ЕД бацитрацина, 120 000 ЕД неомицина и 60 000 ЕД бацитрацина цинка в сочетании с 60 000 ЕД неомицина 14. Частота излечения 95% для бацитрацин цинка, 88% для бацитрацина или комбинации бацитрацин цинк-неомицин и 86% для неомицина.Побочные эффекты были ограничены небольшим числом пациентов, которые испытывали диарею, дискомфорт в животе, запор и тошноту. Из исследования исключались дети младше 10 лет.

Недостатки использования бацитрацина цинка включают возможность нефротоксичности при длительном пероральном приеме и желудочно-кишечные расстройства. Кроме того, на соблюдение может повлиять 10-дневный период дозирования, а составы, используемые Эндрюсом в их исследовании, недоступны. Хотя бацитрацин цинка является многообещающим, необходимы дополнительные исследования, прежде чем он сможет получить широкое признание в качестве агента против G.лямблии .

Новые и экспериментальные терапевтические средства.

Широкий спектр химиотерапевтических агентов, включая рифампицин, битионол, дихлорофен, гексахлорофен, пириметамин, фузидат натрия, хлорохин и мефлохин, продемонстрировал активность in vitro в отношении Giardia 81, 84, 233. Липофильные тетрациклины, такие как доксициклин, сильно активен in vitro; однако их клиническая эффективность ограничена, возможно, из-за их быстрой абсорбции из кишечника 70.Некоторые аналоги пентамидина, а также азитромицин обладают активностью in vitro, сравнимой с активностью метронидазола 25, 33.

Нитазоксанид, производное 5-нитротиазола с широким спектром активности против простейших, гельминтов и некоторых бактерий, показал ограниченную эффективность у взрослых. и у детей в Мексике (эффективность 71% [213] и 78% [211] соответственно) и у нескольких больных СПИДом в Мали 64. Его назначали в дозе от 100 до 500 мг два раза в день в течение 3-7 дней.

Исследования на крысиной модели продемонстрировали эффективность ивермектина в определенных условиях 260.Дисульфирам, активное цинковое соединение, используемое для лечения алкоголизма у людей, демонстрирует значительную эффективность лечения и снижение паразитарной нагрузки на мышиной модели лямблиоза 180.

у племен луо в Восточной Африке метанольные экстракты 21 из 36 исследованных таксонов были летальными или подавляли рост G. lamblia in vitro 124. Экстракты Geranium nivem также показали активность in vitro 45.Иммуномодулирующий растительный препарат Pippali rasayana , часто назначаемый для лечения гельминтозов и хронической дизентерии в Индии, достиг 98% излечения мышиной инфекции с помощью G. lamblia 6. Экстракты плодов Piper longum были эффективны при мышиная модель инфекции 241.

Proposlina, препарат пчелиного клея, продемонстрировал 60% уровень паразитологического излечения через 1 неделю после завершения лечения среди 48 взрослых на Кубе 172, 261. У пациента с резистентной к метронидазолу инфекции Giardia Антагонист β-адренорецепторов dl-пропранолол, назначаемый в дозе 40 мг три раза в день с метронидазолом по 400 мг три раза в день в течение 10 дней, излечил инфекцию, продемонстрировав клиническую эффективность у людей 197.Исследования in vitro демонстрируют, что пропранолол оказывает свое действие, подавляя подвижность и рост простейших, скорее всего, благодаря мембраностабилизирующей активности препарата 85. Однако необходимы дальнейшие исследования dl-пропранолола и родственного соединения d-пропранолола. прежде чем их можно будет рекомендовать в качестве средств против Giardia .

Иммунопрофилактические стратегии для предотвращения или лечения лямблиоза, как правило, не были эффективными 87. Пассивный перенос иммунной сыворотки против Giardia не способствовал элиминации паразитов при лямблиозе мышей 76, 242.Несмотря на то, что пациенты с общим вариабельным иммунодефицитом имеют симптоматическую и длительную инфекцию Giardia , противопаразитарная терапия необходима для контроля их инфекции 106, 216. липазы, стимулируемой солями желчных кислот 204. Кроме того, грудное вскармливание может оказывать некоторую защиту грудным детям 176, 183; однако метод введения энтеральных антител против Giardia не изучался.

Особые ситуации

Беременность и кормление грудью.

Ведение симптоматической инфекции G. lamblia во время беременности является сложной задачей для клинициста, поскольку ни один терапевтический агент не сочетает в себе оптимальную эффективность и безопасность. Женщинам с бессимптомным течением, легкой формой заболевания или в первом триместре обычно следует избегать лечения. Однако женщинам, у которых невозможно поддерживать адекватную гидратацию и нутриционный статус, следует проводить лечение даже в первом триместре.

Метронидазол, который быстро попадает в кровоток плода после поглощения матерью, продемонстрировал мутагенность в отношении бактерий и канцерогенность в отношении мышей и крыс 34, 36, 153, 240, 251. Хотя эта информация вызывает обеспокоенность по поводу использования препарата во время беременности , канцерогенность не была продемонстрирована у людей 23, 24, 78, 98, 212, а также не было тератогенности у грызунов 164a. Метронидазол широко применялся во время беременности (категория беременности В), прежде всего для лечения трихомониаза курсами от 7 до 10 дней [42].Результаты относительно безопасности для плода противоречивы 36, 42, 107, 212, 215, 218. В одном ретроспективном исследовании 1469 женщин, принимавших метронидазол во время беременности, 206 из которых принимали препарат в первом триместре, не было обнаружено признаков врожденных аномалий 26. Тем не менее, Совместный перинатальный проект, включавший более 50 000 пар мать-ребенок, продемонстрировал, что воздействие метронидазола в первом триместре у 31 женщины показало возможную связь с пороками развития 107. Мета-анализ семи исследований, в которых проспективно наблюдали 253 пары мать-ребенок. и ретроспективный мониторинг 1083 пар не выявил повышенного риска пороков развития плода в связи с использованием метронидазола в первом триместре 42, при этом в одном отчете относительный риск оценивается как 0.92 для врожденных дефектов 215. В целом, может быть несколько повышенный риск при использовании метронидазола в течение первого триместра, поэтому его следует избегать в этот период. Короткие курсы высоких доз (≥2,0 г) не следует назначать во время беременности.

Метронидазол активно выделяется с грудным молоком в концентрациях, сходных с таковыми в плазме. Американская академия педиатрии (AAP) рекомендует однократно давать 2 г кормящим матерям с последующим прекращением кормления на 12–24 ч [10, 36].ААР также рекомендует матерям, принимающим тинидазол, прекратить кормление грудью на тот же период времени, что и тем, кто принимает метронидазол 10. Однако метронидазол одобрен для использования у детей для лечения амебиаза и используется у детей для лечения анаэробных инфекций, поэтому может показаться, что небольшое количество, выделяемое в грудное молоко, не будет вредным. Кроме того, поскольку однократные схемы метронидазола с высокими дозами имеют низкую эффективность и, как ожидается, приведут к более высоким уровням в грудном молоке, эти данные свидетельствуют в пользу традиционного лечения более низкими дозами в течение 5–7 дней.

Паромомицин обычно считается безопасным, поскольку он плохо всасывается из кишечника и почти на 100% выводится с калом в неизмененном виде. Поэтому мало, если вообще какое-либо лекарство достигнет плода. Однако он не так эффективен, как метронидазол или акрихин. Кроме того, никакие клинические испытания не изучали влияние высоких концентраций паромомицина в сыворотке крови во время беременности. Тем не менее, паромомицин успешно применялся для эрадикации инфекции G. lamblia у беременных женщин и является важным средством, которое следует рассмотреть в течение первого триместра, когда не следует использовать метронидазол 140, 218.Паромомицин также должен быть безопасным для кормящих матерей. Исследование на овцах показало, что скорость выделения препарата в грудном молоке составляет всего 0,018% в течение 12 часов после парентерального введения 36, 263. ААП определяет, что стрептомицин и канамицин, аминогликозидные родственники паромомицина, совместимы с грудным вскармливанием 10.

Один эксперт по лямблиозу поддержал лечение беременных хинакрином из-за его высокой степени излечения 256. Хотя препарат очень эффективен, его медленное выведение из организма и доказанная тератогенность на крысах делают его неоптимальным выбором для лечения беременных.Хотя хинидин и хинин совместимы с грудным вскармливанием, информации о безопасности хинакрина для детей, находящихся на грудном вскармливании, не имеется 10.

Фуразолидон не рекомендуется беременным. Хотя он эффективен, он вызывает опухоли молочных желез у мышей и мутации бактерий, что должно удерживать врачей от его использования в этих условиях 164b. Его безопасность для детей, находящихся на грудном вскармливании, неизвестна. Альбендазол считается препаратом категории С при беременности и оказывает тератогенное действие на крыс и кроликов, хотя опыт его воздействия на беременных женщин невелик.

Бессимптомная инфекция.

В глобальном масштабе у большинства людей, инфицированных G. lamblia , заболевание протекает бессимптомно или с минимальными симптомами. Лечение бессимптомных пациентов, особенно детей, является спорным вопросом, и перед началом терапии необходимо учитывать несколько факторов. Обстановка инфекции играет ключевую роль в принятии решения. В районах, где G. lamblia является эндемичным, лечение может быть нежелательным, поскольку после лечения дети могут быстро заразиться повторно 96, 231.Если Giardia способствует отсутствию роста и развития 86, 163, 227, лечение, даже если может произойти повторное заражение, может обеспечить догоняющий рост 103 и может стоить затрат и усилий. В этих условиях может быть полезен такой препарат, как альбендазол, который также лечит нематодные инфекции; однако требование 5-дневного дозирования затруднило бы завершение терапии во многих ситуациях.

В условиях, при которых базовый уровень питания ребенка превосходен, например, в детских садах в развитых странах, бессимптомным носителям может не всегда потребоваться терапия 5, 121, 195, 203, 221, 237.Однако следует отметить, что бессимптомно инфицированные дети могут выделять Giardia в течение 195 месяцев, нести его домой членам семьи и, таким образом, инициировать заражение в домашнем хозяйстве и даже способствовать поддержанию высокого уровня инфекции Giardia в сообществе 4, 196, 224; GD Overturf, Editorial, Clin. Заразить. Дис. 18: 764–765, 1994). Нередко у матери маленького ребенка, находящегося в дневном стационаре, появляются симптомы лямблиоза, определяя наличие в домашнем хозяйстве Giardia , который был занесен бессимптомным ребенком.При рецидивирующей диарее, связанной с Giardia , в дневном стационаре, которую нельзя контролировать с помощью улучшения гигиены, лечения и исключения детей с симптомами, можно рассмотреть вопрос о скрининге и лечении всех детей в дневном стационаре 5, 18. , 230.

При обнаружении Giardia в стуле и маловероятности повторного заражения, например, у вернувшегося путешественника, можно назначить лечение. В домашнем хозяйстве, если у одного члена есть симптомы и существует вероятность фекально-орального распространения внутри семьи или наличия общего источника инфекции, все члены семьи должны пройти обследование и лечение, чтобы не произошло повторного заражения.

Другим фактором, который следует учитывать при принятии решения о лечении бессимптомных носителей, являются последствия передачи инфекции, если носитель не лечится, например, заражение работников пищевых продуктов 169, 199. Эту группу следует лечить, чтобы предотвратить вспышки пищевого происхождения.

Резистентность и рецидив.

Сообщалось о неэффективности лечения всеми распространенными препаратами против Giardia , включая метронидазол, хинакрин, фуразолидон и альбендазол. Тем не менее, для клинициста, сталкивающегося с рецидивом симптомов после терапии, важно различать действительную лекарственную устойчивость, излечение с последующим повторным инфицированием и пост- Giardia непереносимость лактозы.Таким образом, первым шагом является документирование истинной персистирующей инфекции путем отправки образца стула на исследование O&P или обнаружение антигена Giardia . Если проба положительна, тщательный анамнез контакта должен предоставить информацию о вероятности повторного заражения, а повторно инфицированные лица должны реагировать на первоначальное терапевтическое средство. Повторное заражение будет обычным явлением в эндемичных регионах по всему миру и в условиях плохой фекально-оральной гигиены. Если у пациента произошло повторное инфицирование, следует выявить факторы риска и проконсультировать пациента относительно правильных мер гигиены и профилактики.

Непереносимость лактозы после введения Giardia является наиболее частым дефицитом дисахаридазы, связанным с лямблиозом, и может возникать у 20–40% пациентов 65. должны быть установлены продукты питания и жидкости. Этот синдром может занять несколько недель, чтобы решить.

Истинная неудача лечения может означать заражение лекарственно-устойчивым изолятом Giardia . Резистентность к большинству агентов против Giardia была задокументирована или индуцирована in vitro 29, 154, 245–247, а также к множеству генотипически различных клонов G.lamblia с чувствительностью к различным классам препаратов были обнаружены в двенадцатиперстной кишке человека 46, 81, 160, 248. Однако не было выявлено последовательной корреляции между резистентностью или чувствительностью in vitro и клинической неудачей или успехом 43, 160, 164, 225, 249, по-прежнему оставляя открытым вопрос об истинной резистентности к паразитам.

Клинически резистентные штаммы лечили более длительными повторными курсами или более высокими дозами исходного агента 91, 165, 178. Однако наиболее эффективным средством искоренения этих инфекций, по-видимому, является использование препарата другого класса, чтобы избежать потенциального перекрестного заражения. сопротивление 52, 92.Первоначальный переход на препарат другого класса не всегда может быть эффективным, как это было продемонстрировано у двух французских пациентов, у которых лечение альбендазолом было неудачным после двух курсов метронидазола, но был ответ на хинакрин (P. Brasseur and L. Favennec, Letter, Parasite 2: 422, 1995). Комбинированные режимы с использованием метронидазола-альбендазола, метронидазола-хинакрина или других активных препаратов или назначение нитроимидазола плюс хинакрина курсом не менее 2 недель доказали свою эффективность при рефрактерной инфекции 44, 182a, 197, 225, 234.Иногда для эффективного лечения потребуются несколько различных комбинаций или подходов.

В случаях лямблиоза, при котором альтернативная терапия неэффективна, следует рассмотреть другие возможности, например наличие иммунологической недостаточности. Хронический лямблиоз у пациентов с гипогаммаглобулинемией хорошо регистрируется 106, 108, 216 и может быть трудно поддающимся лечению, часто требующим длительных курсов терапии. Хотя Giardia наблюдается у гомосексуальных мужчин, занимающихся орально-анальной сексуальной практикой 162, 200, 226, болезнь часто может быть ни тяжелой, ни продолжительной 148.Тем не менее, у больных СПИДом с тяжелым лямблиозом может потребоваться пролонгированная или комбинированная терапия 182a.

Лечение лямблиоза

При оценке клинической эффективности средств, используемых против Giardia , трудно сравнивать исследования. Они различаются по методологии включения (была ли проведена рандомизация и было ли лечение слепым или открытым), изучаемой популяции (дети, взрослые, симптоматические и/или бессимптомные пациенты), показателям результатов (клиническая эффективность и/или отрицательный анализ стула) и продолжительности лечения. следовать за.Тем не менее, если рассматривать исследования в целом, можно сделать выводы и сделать выводы об относительной эффективности препаратов.

Классы агентов и клинические свойства

Нитроимидазолы.

Класс нитроимидазолов, используемых для лечения инфекции G. lamblia , включает метронидазол, тинидазол, орнидазол и секнидазол. Этот класс был открыт в 1955 году, и было обнаружено, что он очень эффективен против нескольких протозойных инфекций 240.Метронидазол [1-(β-гидроксиэтил)-2-метил-5-нитроимидазол; Flagyl] был определен как терапевтический против Trichomonas vaginalis и Entamoeba histolytica после его открытия в конце 1950-х годов 67, а в 1962 году Darbon et al. сообщили, что его можно использовать для лечения лямблиоза 57. С момента этого открытия клиницисты использовали метронидазол и другие нитроимидазолы в качестве основы для лечения лямблиоза.

Из нитроимидазолов наиболее тщательно изучен механизм уничтожения Giardia метронидазолом.Метронидазол использует анаэробные метаболические пути, присутствующие в Giardia . Лекарство попадает в трофозоит, и как только он оказывается внутри клетки, электронтранспортные белки ферредоксины от паразита отдают электроны нитрогруппе лекарства 223, 238, 244. Лекарство «активируется» путем восстановления этой нитрогруппы 223, 238, 240, и с помощью этой восстановительной реакции устанавливается градиент, способствующий внутриклеточному транспорту метронидазола. Восстановленный метронидазол служит терминальным акцептором электронов, который ковалентно связывается с макромолекулами ДНК 72, 177.Это приводит к повреждению ДНК в виде потери спиральной структуры, нарушения функции матрицы и обрыва цепи с последующей гибелью трофозоитов 95. В дополнение к этому эффекту метронидазол ингибирует дыхание трофозоитов 81, 189. Восстановительная активация метронидазола также может к токсическим радикалам, которые реагируют с основными клеточными компонентами 244. Трофозоиты внутри кист могут быть менее подвержены влиянию нитроимидазолов, возможно, из-за плохого проникновения лекарства через стенку кисты 236.Резистентность к метронидазолу индуцируется in vitro 29. Это коррелирует со снижением активности пируват:ферредоксин оксидоредуктазы паразита, которая необходима для восстановительной активации нитроимидазолов 239, 247.

Метронидазол быстро и полностью всасывается после перорального приема и проникает в ткани организма и выделения, такие как слюна, грудное молоко, сперма и вагинальные выделения 240. Препарат метаболизируется в основном в печени и выводится с мочой 147.

Анализы in vitro на чувствительность к нитроимидазолу проводились с G.lamblia с 1980 г. 112. Используя микроскопическую оценку морфологии и подвижности паразита, Jokipii и Jokipii впервые продемонстрировали эффективность метронидазола и тинидазола 129. Впоследствии морфология 13, 166, 175, ингибирование роста 56, 69, 94, 116, 160, 225 , [ 3 H] тимидина 32, 117, 164, уничтожение сыворотки 114, исключение витального красителя 114, 235, ингибирование прилипания 21, 55, 79, 166, 192, метаболический 228 и колориметрический 133 анализы. для измерения in vitro реакции препарата на многие терапевтические агенты.Однако, как показывает разнообразие используемых анализов, не существует стандарта для тестирования in vitro, что затрудняет сравнение результатов и применение результатов in vitro в клинических условиях.

Из нитроимидазолов тинидазол и метронидазол постоянно демонстрируют наибольшую активность in vitro; тинидазол обладает небольшим преимуществом 30, 32, 55, 101. Более высокозамещенные нитроимидазолы, такие как миконазол, клотримазол, итраконазол и кетоконазол, были разработаны из-за их противогрибковой активности и не являются эффективными средствами против G.lamblia 55. Чувствительность к нитроимидазолам может варьироваться в зависимости от штаммов и клонов G. lamblia , используемых в тестировании 29, 31, 79, 160.

В США метронидазол является единственным представителем класса нитроимидазолов, доступным для лечить лямблиоз; это также наиболее распространенный препарат, используемый для лечения во всем мире. Несмотря на его широкое и общепринятое использование против Giardia , Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США никогда не одобряло его для этого показания. В клинических испытаниях применяли дозирование два и три раза в день (обычно 250 мг/доза) в течение 5–10 дней и короткий курс (1–3 дня), однократную ежедневную терапию (2.0 или 2,4 г/доза) 261. При 5-10-дневном режиме лечения эффективность колеблется от 60 до 100 % у взрослых и детей, при этом медиана эффективности в обеих группах составляет 92 % (таблица) 20, 49, 68. , 91, 92, 100, 127, 132, 135, 150, 151, 191, 201, 202, 232, 256. В целом этот график хорошо переносится, с большинством побочных эффектов, связанных с желудочно-кишечными расстройствами и металлическим привкусом (таблица).

Таблица 1

Таблица 1

Эффективность препаратов Анти- Гиардиа У взрослой и детской инфекции A

–2,4 г, разовая доза

9009 0 1

Таблица 2

Таблица 2

Рекомендуемое дозирование и неблагоприятное воздействие анти- Гиардиа препараты

Препарат
Препарат Доза B Средняя эффективность (%) C Диапазон эффективности (%) )
Метронидазол 500–750 мг/день × 5–10 дней 88 60–95 7 2 0059
48 36–60
2,0–2,4 г, 4 раза в сутки × 2 дня 71 67–80
2,0–2,4 г, 4 раза в сутки. × 3 дня 93-100 93-100
15-22,5 мг / кг / день × 5-10 дней D 94
Tinidazole 300 мг / день × 7 дней 87 74–100
1.0-2,0 г, одна доза 92 86-100 86-100
50 мг / кг, одиночная доза D 91 91 80-96
Орнидазол 1.0-2,0 г , Одноместный доза 96-100
40-50 мг / кг, одна доза D 92-100
Secnidazole 2,0 г, одна доза 86-100
30 мг / кг, 1 или 2 дозы D 88-100 88-100
Quinacrine 300 мг / день × 5-7 дней 95 -100
6-8 мг / кг / день × 5-10 дней D 92-95 92-95
Furazolidone 400 мг / день × 7-10 дней 80–85
8 мг/кг/ День × 7-10 дней D 92 81-96 81-96
albendazole 200-800 мг / день × 1-3 дня 24-81
200- 400 мг / день × 5-7 дней 94-100 94-100
Paromomycin
10-50 мг / кг / день или 1500 мг / день × 5-10 дней 55-88
Бацитрацин цинка 240 000 u / день × 10 дней 95
95
B
препарат Взрослый доза f Детская доза Побочные эффекты
Метронидазол a 250 мг t.я бы. × 5–7 дней 5 мг/кг 3 раза в день × 5-7 дней головная боль, Vertigo, тошнота, металлический вкус, urticaria
дисульфирам-подобной реакции с алкоголем 10070
редкий: панкреатит, центральный нервный системная токсичность, обратимая нейтропения, периферическая нейтропатия, уплощение зубца Т при длительном применении
Мутагенный/канцерогенный?
Tinidazole B 2 г, одна доза 50 мг / кг, одна доза (макс, 2 г) как для Metronidazole
Ornidazole C 2 г, одна доза 40–50 мг/кг, разовая доза (макс. 2 г) То же, что и метронидазол
Хинакрин c 100 мг t.я бы. × 5–7 дней 2 мг/кг 3 раза в день × 7 дней тошнота и рвота, головокружение, головная боль
редко: токсичный психоз
Furazolidone д 100 мг четыре раза в день × 7–10 дней 2 мг/кг 4 раза в день × 10 дней Тошнота, рвота, диарея
Коричневое окрашивание мочи; дисульфиры-подобная реакция с употреблением алкоголя
реагирует неблагоприятно с ингибиторами МАО
Мягкого гемолиза при дефиците G6PDH
Канцерогенных?
Паромомицин a 500 мг t.я бы. × 5–10 дней 30 мг/кг/день в 3 приема × 5–10 дней Ототоксичность и нефротоксичность при системном введении
Альбендазол a 400 мг 4 раза в сутки × 5 дней 15 мг / кг / день × 5-7 дней (макс, 400 мг) анорексия, запор
редко: обратимые нейтропения и повышенные функции печени
Тератогенный?
Бацитрацин цинк e 120 000 U b.я бы. × 10 дней не проверено у детей до 10 лет тошнота, рвота, брюшной дискомфорт
нефротоксичность с системным поглощением

Одно доза, краткосрочные процедуры высокая доза ежедневно) были разработаны для улучшения соблюдения режима лечения без ущерба для эффективности. Их применяли как у взрослых, так и у детей. Эти схемы, как правило, менее эффективны, особенно если вводится только одна доза метронидазола.Эффективность однократной терапии колеблется от 36 до 60% при назначении препарата в течение 1 дня 16, 93, 127, 130, 220, 229 и повышается до 67–80% при назначении препарата в течение 2 дней (табл. ). 127, 130, 146; Э. Грин, Д. М. Линч, Дж. А. Макфадзин и И. М. Пью, Письмо, Бр. Мед. J. 2: 411–412, 1974). Продолжение однократной дозы в течение 3 дней увеличивает эффективность до уровня, наблюдаемого при более низких дозах и более длительном курсе терапии 229; Грин и др., письмо). Схемы с высокими дозами также могут иметь больше побочных эффектов 127.

Дети были включены во многие испытания как длительного, так и короткого курса терапии, с результатами, аналогичными таковым у взрослых, и эффективностью от 80 до 100% (медиана 94%) при 5-10-дневных схемах лечения 91 , 100, 132, 135, 186, 201, 232; А. Растегар-Лари и А. Салек-Могхаддам, Письмо, J. Trop. Педиатр. 42: 184–185, 1996). Хотя метронидазол не выпускается в стандартной жидкой форме, суспензию можно приготовить путем тщательного измельчения таблеток метронидазола, использования капли глицерина в качестве смазки и суспендирования смеси в вишневом сиропе NF 150.

Наиболее частые побочные эффекты лечения метронидазолом включают головную боль, головокружение, тошноту и металлический привкус во рту (таблица). Тошнота возникает у 5-15% пациентов, получающих стандартные многодневные курсы [135, 151]. Кроме того, метронидазолу приписываются панкреатит, токсическое действие на центральную нервную систему [144, 212] и транзиторная обратимая нейтропения [147]. избегайте употребления алкоголя при приеме метронидазола. Ингибирование альдегиддегидрогеназы метронидазолом может вызвать сильную рвоту, приливы, головную боль и желудочно-кишечные боли после приема алкоголя.

Метронидазол оказывает мутагенное действие на бактерии и канцерогенное действие на мышей и крыс в высоких дозах в течение длительного времени 34, 153, 240, 251. Однако мутагенность у людей никогда не регистрировалась, что позволяет предположить, что использование метронидазола в этом отношении безопасно 23, 78, 98, 212. Это может, однако, смягчить воздействие коротких курсов высоких доз у детей.

Обнаружение терапевтической эффективности метронидазола побудило исследователей разработать и испытать другие производные нитроимидазола.Другие препараты, тинидазол, орнидазол и секнидазол, имеют более длительный период полувыведения, что делает их подходящими для однократной терапии суточными дозами 217. Одна доза тинидазола (Фазигин) была успешно использована в 1971 г. в группе шведских студентов, заболевших лямблиозом. во время визита в Россию 11. Эта однократная доза 2 г (или эквивалент для детей) последовательно доказывала клиническую эффективность от 80 до 100% со средней эффективностью 92% (таблица) 16, 126, 130, 131 , 146, 151, 193, 222, 229, 261; З. Фарид, Н.A. El Masry, W. F. Miner и A. Hassan, Letter, Lancet ii: 721, 1974; Т. Петтерссон, Письмо, Бр. Мед. J. 1: 395, 1975) и намного превосходит метронидазол при прямом сравнении режимов однократной дозы 93, 130, 229, 261. Также наблюдается улучшенное соблюдение этой схемы дозирования. Рекомендуемая доза для детей обычно составляет 50 мг/кг для однократной дозы (таблица) 82, 193, 232, 256, и препарат доступен в виде жидкой суспензии.

Побочные эффекты тинидазола встречаются не так часто, как метронидазол, но включают горечь, головокружение и желудочно-кишечные расстройства (таблица) 130, 131; Петтерссон, письмо).Тинидазол недоступен в Соединенных Штатах, но поставщики медицинских услуг рекомендуют некоторым путешественникам, особенно путешествующим в течение длительного времени или путешествующим по суше в Азии, приобрести препарат по прибытии в страну назначения и принимать его в случае заражения лямблиозом 113.

Другим производным нитроимидазола, которое также недоступно в США, является орнидазол. Было проведено меньше исследований с орнидазолом, но он обладает превосходной эффективностью при приеме в течение нескольких дней и эффективностью, аналогичной тинидазолу (от 92 до 100%), при однократном приеме 19, 131, 145, 220, 232, 261.Однократная доза орнидазола (40 мг/кг) также назначалась детям с очевидными преимуществами в отношении соблюдения режима и стоимости [39, 186]. рутинное использование этого препарата у детей до завершения широкомасштабных исследований рецидивов, канцерогенности и побочных эффектов 39.

Секнидазол, производное 5-нитроимидазола длительного действия, использовался, но недоступен в США.Подобно тинидазолу и орнидазолу, секнидазол обычно назначают однократно. Наиболее распространенная схема составляет 2 г для взрослых и 30 мг/кг для детей 95. Клинические исследования демонстрируют уровень эффективности более 85% при однократном приеме у взрослых 49; Р. Бакай, Х. Куреши и С. Дж. Зубери; Письмо, Дж. Пак. Мед. доц. 45:288, 1995), а у детей эта доза так же эффективна, как 7-10-дневный курс метронидазола 100; Растегар-Лари и Салек-Могаддам, Письмо). Препарат быстро и полностью всасывается, имеет период полувыведения от 17 до 29 часов и метаболизируется путем окисления в печени 95.Сообщалось о побочных эффектах, в первую очередь желудочно-кишечных расстройствах (тошноте, анорексии и боли в животе) и головокружении, но обычно не требующих отмены препарата.

Квинакрин.

Хинакрин (атабрин) был впервые представлен в качестве противомалярийного средства в 1930 году после работы Кикута и стал предпочтительным противомалярийным средством для союзных войск во время Второй мировой войны из-за его большей доступности и лучшей переносимости по сравнению с хинином 240. После войны, вскоре он стал важным агентом против G.lamblia с клинической эффективностью 90% и более 20, 52, 105, 255. Однако, поскольку рынок США ограничен лечением Giardia , использование хинакрина сократилось, и его производство в США было прекращено. в 1992 г., хотя его все еще можно получить из альтернативных источников (таблица).

Противопротозойный механизм хинакрина до конца не выяснен. Препарат легко встраивается в ДНК G. lamblia , и считается, что именно это взаимодействие вызывает ингибирование синтеза нуклеиновых кислот 240.Различная относительная скорость поглощения хинакрина между человеческими и клетками G. lamblia может быть причиной селективной токсичности препарата 236. In vitro хинакрин снижает жизнеспособность цист и скорость их эксцистации 179, 189. Резистентность индуцируется in vitro, а в в одном исследовании это коррелировало со снижением усвоения препарата 246. Квинакрин быстро всасывается из кишечного тракта и широко распределяется в тканях организма.

Хотя результаты различаются в зависимости от используемого теста чувствительности in vitro, было показано, что метронидазол и фуразолидон немного более эффективны, чем хинакрин 30, 32, 55, 94.Однако в других исследованиях in vitro эффективность хинакрина и метронидазола одинакова 21, 117, 164. Некоторые из этих различий могут быть связаны с большей вариабельностью чувствительности к хинакрину, чем к метронидазолу или фуразолидону между клонами Giardia 31.

Клинически хинакрин очень эффективен: исследования показали, что его эффективность в течение 5-10 дней составляет около 95% (таблица) 20, 135, 220, 255. Некоторые исследователи считают этот препарат наиболее эффективным из всех анти- Giardia терапевтические средства 256.Дозировка обычно составляет 100 мг три раза в день в течение 5–7 дней для взрослых и 6 мг/кг/день в три приема в течение 5–7 дней для детей (таблица) 150.

Побочные эффекты не позволяют многим врачам использовать хинакрин. , особенно у детей (таблица). Горький вкус наряду с рвотой отмечался у 28% участников исследования 20, 52 и приводил к более низкой эффективности у детей младше 5 лет 52, вероятно, из-за низкой приверженности лечению. Желто-оранжевое обесцвечивание кожи, склер и мочи наблюдается у 4-5% пациентов, принимающих хинакрин, начиная примерно через 1 неделю после начала лечения и может сохраняться до 4 месяцев после прекращения терапии.Другие распространенные побочные эффекты включают тошноту, рвоту, головную боль и головокружение 254. Лекарственный психоз встречается редко, а эксфолиативный дерматит и ретинопатия, вызванная хинакрином, встречаются редко 82. Хинакрин может усугублять псориаз, а глюкозо-6-фосфатдегидрогеназа (Г6ФДГ) может усугублять течение псориаза. -дефицитные люди, это может вызвать гемолиз. Противопоказан при беременности из-за возможной связи с расщеплением позвоночника и агенезией почек. Никогда не было доказано, что он канцерогенен, хотя он имеет механизм действия связывания с ДНК.

Фуразолидон.

Фуразолидон (фуроксон) является одним из тысяч нитрофурановых соединений, созданных с момента открытия этого класса в 1940-х годах143. Он эффективен против многих бактерий, включая Klebsiella spp., Clostridium spp., Escherichia coli , , Campylobacter spp. и Staphylococcus aureus . Еще в 1950-х годах фуразолидон использовался для лечения лямблиоза 253. Он одобрен для использования в Соединенных Штатах и ​​остается важным терапевтическим средством во всем мире.Из распространенных терапевтических средств против Giardia это единственное, доступное в США в виде жидкой суспензии; поэтому его использование было рекомендовано в педиатрической популяции 150.

Механизм действия фуразолидона против G. lamblia , как и многих противопаразитарных средств, полностью не объяснен. Препарат подвергается восстановительной активации в трофозоите G. lamblia , но, в отличие от метронидазола, восстановление, возможно, происходит с помощью НАДН-оксидазы 38, 244.Его убивающий эффект коррелирует с токсичностью восстановленных продуктов, которые могут повредить важные клеточные компоненты, включая ДНК. Резистентность к фуразолидону может быть связана с уменьшением проникновения лекарственного средства 246 или с повышенным уровнем тиол-циклирующих ферментов, которые могут защищать от токсичных радикалов 249. Лекарственное средство легко всасывается через желудочно-кишечный тракт и быстро метаболизируется в тканях, что приводит к низким концентрациям в сыворотке и моче 143.

В тестах на чувствительность in vitro фуразолидон действует сравнимо с метронидазолом и постоянно демонстрирует самую высокую активность среди неимидазолов 32, 55, 101; он более активен, чем хинакрин 30.

Клинические исследования с использованием фуразолидона многочисленны и были завершены с широким кругом субъектов, доз и графиков введения. Хотя его эффективность обычно считается несколько ниже, чем у метронидазола и хинакрина, сообщалось о показателях излечения от 80 до 96% при 7-10-дневных курсах (таблица) 20, 52, 91, 151, 178, 191. , 201, 255. Когда препарат принимается всего 5 дней, его эффективность значительно падает 151, 178. Его назначают в виде четырех доз в день как взрослым (100 мг на дозу), так и детям (1.5 мг/кг) (таблица). В педиатрической суспензии две столовые ложки заменяют таблетку по 100 мг.

Около 10% пациентов сообщают о желудочно-кишечных симптомах, таких как тошнота, рвота и диарея (таблица ) 150, 256. Другие побочные эффекты могут включать изменение цвета мочи на коричневый; гемолиз может возникать у пациентов с дефицитом G6PDH. Препарат оказывает ингибирующее действие на моноаминоксидазу (МАО), и его никогда не следует назначать одновременно лицам, уже принимающим ингибиторы МАО. Были редкие сообщения о дисульфирамоподобных реакциях при приеме с алкоголем 164b.Сообщалось о маниакальном эпизоде, вызванном фуразолидоном, у пациента, инфицированного вирусом иммунодефицита человека 73. Фуразолидон также противопоказан детям в возрасте до 1 месяца, у которых может развиться гемолитическая анемия из-за обычно нестабильного глутатиона. Наконец, препарат оказывает мутагенное действие на бактерии и, как было показано, вызывает опухоли молочных желез у крыс и опухоли легких у мышей при длительном приеме в высоких дозах. Однако значение этого открытия для человека неизвестно и не было адекватно рассмотрено 143, 164b, 236.При лечении детей преимущества минимальных побочных эффектов и доступности жидкой суспензии необходимо сопоставлять с необходимостью частого введения в течение 10-дневного периода лечения.

Бензимидазолы.

Два представителя класса бензимидазолов, альбендазол (Albenza) и мебендазол (Vermox), использовались для лечения инфекции G. lamblia 155. Клинические исследования и исследования эффективности in vitro дали разные результаты в отношении их эффективности.Однако сравнительно мягкий профиль побочных эффектов в сочетании с доказанной эффективностью против многих гельминтов делает их перспективными для лечения 208, 250. -тубулиновый цитоскелет 71, 175, 209. Это связывание вызывает как ингибирование полимеризации цитоскелета, так и нарушение захвата глюкозы 250. Хотя точное место связывания на цитоскелете не определено, постулируется, что взаимодействие бензимидазол-колхицин может играть определенную роль. 51, 166, 236.Бензимидазолы плохо всасываются из желудочно-кишечного тракта, хотя это можно улучшить при одновременном приеме жирной пищи. Системный эффект альбендазола обусловлен его первичным метаболитом, альбендазолсульфоксидом, который быстро образуется в печени после абсорбции 3. Выведение почками незначительно.

Тестирование in vitro чувствительности G. lamblia к бензимидазолам ограничено по сравнению с чувствительностью паразита к нитроимидазолам или хинакрину.Тем не менее, исследования демонстрируют значительный эффект in vitro 79, 175, 208, 209. В одном отчете показано, что и альбендазол, и мебендазол были в 30-50 раз более активны, чем метронидазол, и в 4-40 раз более активны, чем хинакрин in vitro 71. Другой продемонстрировал, что способность альбендазола влиять на морфологию, прилипание и жизнеспособность трофозоитов была намного выше, чем у метронидазола или тинидазола 166. Однако их переменная клиническая эффективность демонстрирует несоответствие между тестированием in vitro и активностью in vivo.Резистентность к альбендазолу может быть индуцирована in vitro 154 и коррелирует с изменениями в цитоскелете паразита 243. Другие бензимидазолы, такие как нокодазол, оксфендазол, тиабендазол и фенбендазол, также продемонстрировали некоторую эффективность in vitro 236.

Клинические испытания ограничивались альбендазолом и мебендазол со смешанными результатами. Холл и Нахар сообщили о равной лечебной эффективности альбендазола и метронидазола у детей, когда альбендазол назначался в течение 5 дней, но не при однократном или трехдневном приеме (таблица) 104.Снижение эффективности альбендазола при приеме в течение 3 дней или менее также было задокументировано Kollaritsch et al. у путешественников с лямблиозом 137, Pungpak et al. у детей и взрослых 198, и Pengsaa et al. у детей 193. Повышение эффективности наблюдалось у других пациентов, когда препарат назначался в течение 5 дней 171, 207, 214 или 7 дней 198. Исключение в отношении необходимости более длительных курсов лечения наблюдалось в одном исследовании, в котором вводилась однократная доза 68. Комбинация альбендазол-метронидазол была эффективна на 100% у 20 пациентов с резистентным к метронидазолу лямблиозом, у которых от трех до пяти курсов стандартной пероральной терапии метронидазолом не удавалось 44.

Лечение мебендазолом привело к сильно различающимся клиническим результатам. Al-Waili сообщил о более чем 90% эффективности в двух исследованиях у детей 8, 9. Однако другие исследования как у детей, так и у взрослых не показали одинакового успеха, но вместо этого показали эффективность у 80% 211 и у 60% или менее 39, 92 , 132; Л. ди Мартино, А. Ночерино и М. Петтоелло Мантовани, Письмо, пер. Р. Соц. Троп. Мед. Гиг. 85: 557–558, 1991), а также отсутствие снижения показателей распространенности Giardia при использовании мебендазола при массовом лечении гельминтов 219.Из-за этого несоответствия наибольший интерес был сосредоточен на альбендазоле.

Дозировка для взрослых обычно составляет 400 мг в день в течение 5 дней для альбендазола и 200–400 мг в день в течение 5–10 дней для мебендазола (таблица). Обычная доза для детей составляет 15 мг/кг в сутки в течение 5–7 дней. Оба препарата доступны в виде суспензии. Одним из преимуществ использования альбендазола у детей является его эффективность против многих гельминтов, что позволяет эффективно лечить множество кишечных паразитов 207, 208. Другим преимуществом является относительное отсутствие побочных эффектов.Однако при кратковременном употреблении он может вызвать желудочно-кишечные проблемы, такие как анорексия и запор. Длительное применение альбендазола в высоких дозах, например, при личиночных цестодных инфекциях, вызывает обратимую нейтропению и повышение уровня печеночных ферментов [3, 155, 258]. Альбендазол противопоказан при беременности из-за возможного тератогенного действия (категория беременности). C), но исследования на животных не показали увеличения канцерогенной заболеваемости.

Паромомицин.

Паромомицин (хуматин), член семейства аминогликозидов, был впервые выделен в 1956 году.Он показан для лечения Entamoeba histolytica и Trichomonas и был предложен для лечения G. lamblia при резистентных инфекциях и во время беременности 113, 140. Паромомицин плохо всасывается из просвета кишечника; даже при пероральном введении больших доз достигаются лишь минимальные концентрации в крови и моче пациентов с нормальной функцией почек 140. Паромомицин ингибирует синтез белка G. lamblia , вмешиваясь в 50S- и 30S-субъединицы рибосомы (рРНК паразита имеет необычный размер и последовательность) и вызывая неправильное прочтение кодонов мРНК 69.

Анализ чувствительности in vitro показывает, что паромомицин обладает активностью в отношении G. lamblia , но в целом активность ниже, чем у нитроимидазолов, хинакрина или фуразолидона 30, 101. Однако из-за плохой кишечной абсорбции он компенсирует его низкая противопротозойная активность за счет достижения высокого уровня в кишечнике. В модели на крысах препарат показал эффективность 15.

Клинические исследования ограничены, терапевтическая эффективность колеблется от 55 до почти 90% (таблица) 47, 63, 140, 191, 218.Обычная доза составляет 500 мг три раза в день в течение 10 дней для взрослых и 25-30 мг/кг/день (разделенная на три приема) для детей (таблица).

Как и другие аминогликозиды, при системном всасывании паромомицин может вызывать ототоксичность и нефротоксичность. Однако он может быть менее ототоксичен, чем другие аминогликозиды 142, и при ограниченной системной абсорбции токсичность не должна вызывать беспокойства у людей с нормальными почками. Тем не менее, его следует использовать с осторожностью у пациентов с нарушением функции почек.

Бацитрацин цинк.

Поиск альтернативных эффективных препаратов против Giardia привел исследователей к рассмотрению вопроса о бацитрацине. Бацитрацин был впервые выделен в 1945 г. из штамма Bacillus и применялся системно против тяжелых стафилококковых инфекций до 1960 г., когда его токсичность и доступность других антибиотиков ограничили его главным образом местным применением. стабильность. Бацитрацин оказывает свое действие на бактерии, препятствуя стадии дефосфорилирования в синтезе клеточной мембраны.После продемонстрированной in vitro эффективности против E. histolytica и Trichomonas , бацитрацин цинка был протестирован in vitro против Giardia и оказался активным 12, 13.

Клиническое исследование, проведенное Andrews et al. использовали два раза в день в течение 10 дней и сравнили эффективность 120 000 ЕД бацитрацина цинка, 120 000 ЕД бацитрацина, 120 000 ЕД неомицина и 60 000 ЕД бацитрацина цинка в сочетании с 60 000 ЕД неомицина 14. Частота излечения 95% для бацитрацин цинка, 88% для бацитрацина или комбинации бацитрацин цинк-неомицин и 86% для неомицина.Побочные эффекты были ограничены небольшим числом пациентов, которые испытывали диарею, дискомфорт в животе, запор и тошноту. Из исследования исключались дети младше 10 лет.

Недостатки использования бацитрацина цинка включают возможность нефротоксичности при длительном пероральном приеме и желудочно-кишечные расстройства. Кроме того, на соблюдение может повлиять 10-дневный период дозирования, а составы, используемые Эндрюсом в их исследовании, недоступны. Хотя бацитрацин цинка является многообещающим, необходимы дополнительные исследования, прежде чем он сможет получить широкое признание в качестве агента против G.лямблии .

Новые и экспериментальные терапевтические средства.

Широкий спектр химиотерапевтических агентов, включая рифампицин, битионол, дихлорофен, гексахлорофен, пириметамин, фузидат натрия, хлорохин и мефлохин, продемонстрировал активность in vitro в отношении Giardia 81, 84, 233. Липофильные тетрациклины, такие как доксициклин, сильно активен in vitro; однако их клиническая эффективность ограничена, возможно, из-за их быстрой абсорбции из кишечника 70.Некоторые аналоги пентамидина, а также азитромицин обладают активностью in vitro, сравнимой с активностью метронидазола 25, 33.

Нитазоксанид, производное 5-нитротиазола с широким спектром активности против простейших, гельминтов и некоторых бактерий, показал ограниченную эффективность у взрослых. и у детей в Мексике (эффективность 71% [213] и 78% [211] соответственно) и у нескольких больных СПИДом в Мали 64. Его назначали в дозе от 100 до 500 мг два раза в день в течение 3-7 дней.

Исследования на крысиной модели продемонстрировали эффективность ивермектина в определенных условиях 260.Дисульфирам, активное цинковое соединение, используемое для лечения алкоголизма у людей, демонстрирует значительную эффективность лечения и снижение паразитарной нагрузки на мышиной модели лямблиоза 180.

у племен луо в Восточной Африке метанольные экстракты 21 из 36 исследованных таксонов были летальными или подавляли рост G. lamblia in vitro 124. Экстракты Geranium nivem также показали активность in vitro 45.Иммуномодулирующий растительный препарат Pippali rasayana , часто назначаемый для лечения гельминтозов и хронической дизентерии в Индии, достиг 98% излечения мышиной инфекции с помощью G. lamblia 6. Экстракты плодов Piper longum были эффективны при мышиная модель инфекции 241.

Proposlina, препарат пчелиного клея, продемонстрировал 60% уровень паразитологического излечения через 1 неделю после завершения лечения среди 48 взрослых на Кубе 172, 261. У пациента с резистентной к метронидазолу инфекции Giardia Антагонист β-адренорецепторов dl-пропранолол, назначаемый в дозе 40 мг три раза в день с метронидазолом по 400 мг три раза в день в течение 10 дней, излечил инфекцию, продемонстрировав клиническую эффективность у людей 197.Исследования in vitro демонстрируют, что пропранолол оказывает свое действие, подавляя подвижность и рост простейших, скорее всего, благодаря мембраностабилизирующей активности препарата 85. Однако необходимы дальнейшие исследования dl-пропранолола и родственного соединения d-пропранолола. прежде чем их можно будет рекомендовать в качестве средств против Giardia .

Иммунопрофилактические стратегии для предотвращения или лечения лямблиоза, как правило, не были эффективными 87. Пассивный перенос иммунной сыворотки против Giardia не способствовал элиминации паразитов при лямблиозе мышей 76, 242.Несмотря на то, что пациенты с общим вариабельным иммунодефицитом имеют симптоматическую и длительную инфекцию Giardia , противопаразитарная терапия необходима для контроля их инфекции 106, 216. липазы, стимулируемой солями желчных кислот 204. Кроме того, грудное вскармливание может оказывать некоторую защиту грудным детям 176, 183; однако метод введения энтеральных антител против Giardia не изучался.

Особые ситуации

Беременность и кормление грудью.

Ведение симптоматической инфекции G. lamblia во время беременности является сложной задачей для клинициста, поскольку ни один терапевтический агент не сочетает в себе оптимальную эффективность и безопасность. Женщинам с бессимптомным течением, легкой формой заболевания или в первом триместре обычно следует избегать лечения. Однако женщинам, у которых невозможно поддерживать адекватную гидратацию и нутриционный статус, следует проводить лечение даже в первом триместре.

Метронидазол, который быстро попадает в кровоток плода после поглощения матерью, продемонстрировал мутагенность в отношении бактерий и канцерогенность в отношении мышей и крыс 34, 36, 153, 240, 251. Хотя эта информация вызывает обеспокоенность по поводу использования препарата во время беременности , канцерогенность не была продемонстрирована у людей 23, 24, 78, 98, 212, а также не было тератогенности у грызунов 164a. Метронидазол широко применялся во время беременности (категория беременности В), прежде всего для лечения трихомониаза курсами от 7 до 10 дней [42].Результаты относительно безопасности для плода противоречивы 36, 42, 107, 212, 215, 218. В одном ретроспективном исследовании 1469 женщин, принимавших метронидазол во время беременности, 206 из которых принимали препарат в первом триместре, не было обнаружено признаков врожденных аномалий 26. Тем не менее, Совместный перинатальный проект, включавший более 50 000 пар мать-ребенок, продемонстрировал, что воздействие метронидазола в первом триместре у 31 женщины показало возможную связь с пороками развития 107. Мета-анализ семи исследований, в которых проспективно наблюдали 253 пары мать-ребенок. и ретроспективный мониторинг 1083 пар не выявил повышенного риска пороков развития плода в связи с использованием метронидазола в первом триместре 42, при этом в одном отчете относительный риск оценивается как 0.92 для врожденных дефектов 215. В целом, может быть несколько повышенный риск при использовании метронидазола в течение первого триместра, поэтому его следует избегать в этот период. Короткие курсы высоких доз (≥2,0 г) не следует назначать во время беременности.

Метронидазол активно выделяется с грудным молоком в концентрациях, сходных с таковыми в плазме. Американская академия педиатрии (AAP) рекомендует однократно давать 2 г кормящим матерям с последующим прекращением кормления на 12–24 ч [10, 36].ААР также рекомендует матерям, принимающим тинидазол, прекратить кормление грудью на тот же период времени, что и тем, кто принимает метронидазол 10. Однако метронидазол одобрен для использования у детей для лечения амебиаза и используется у детей для лечения анаэробных инфекций, поэтому может показаться, что небольшое количество, выделяемое в грудное молоко, не будет вредным. Кроме того, поскольку однократные схемы метронидазола с высокими дозами имеют низкую эффективность и, как ожидается, приведут к более высоким уровням в грудном молоке, эти данные свидетельствуют в пользу традиционного лечения более низкими дозами в течение 5–7 дней.

Паромомицин обычно считается безопасным, поскольку он плохо всасывается из кишечника и почти на 100% выводится с калом в неизмененном виде. Поэтому мало, если вообще какое-либо лекарство достигнет плода. Однако он не так эффективен, как метронидазол или акрихин. Кроме того, никакие клинические испытания не изучали влияние высоких концентраций паромомицина в сыворотке крови во время беременности. Тем не менее, паромомицин успешно применялся для эрадикации инфекции G. lamblia у беременных женщин и является важным средством, которое следует рассмотреть в течение первого триместра, когда не следует использовать метронидазол 140, 218.Паромомицин также должен быть безопасным для кормящих матерей. Исследование на овцах показало, что скорость выделения препарата в грудном молоке составляет всего 0,018% в течение 12 часов после парентерального введения 36, 263. ААП определяет, что стрептомицин и канамицин, аминогликозидные родственники паромомицина, совместимы с грудным вскармливанием 10.

Один эксперт по лямблиозу поддержал лечение беременных хинакрином из-за его высокой степени излечения 256. Хотя препарат очень эффективен, его медленное выведение из организма и доказанная тератогенность на крысах делают его неоптимальным выбором для лечения беременных.Хотя хинидин и хинин совместимы с грудным вскармливанием, информации о безопасности хинакрина для детей, находящихся на грудном вскармливании, не имеется 10.

Фуразолидон не рекомендуется беременным. Хотя он эффективен, он вызывает опухоли молочных желез у мышей и мутации бактерий, что должно удерживать врачей от его использования в этих условиях 164b. Его безопасность для детей, находящихся на грудном вскармливании, неизвестна. Альбендазол считается препаратом категории С при беременности и оказывает тератогенное действие на крыс и кроликов, хотя опыт его воздействия на беременных женщин невелик.

Бессимптомная инфекция.

В глобальном масштабе у большинства людей, инфицированных G. lamblia , заболевание протекает бессимптомно или с минимальными симптомами. Лечение бессимптомных пациентов, особенно детей, является спорным вопросом, и перед началом терапии необходимо учитывать несколько факторов. Обстановка инфекции играет ключевую роль в принятии решения. В районах, где G. lamblia является эндемичным, лечение может быть нежелательным, поскольку после лечения дети могут быстро заразиться повторно 96, 231.Если Giardia способствует отсутствию роста и развития 86, 163, 227, лечение, даже если может произойти повторное заражение, может обеспечить догоняющий рост 103 и может стоить затрат и усилий. В этих условиях может быть полезен такой препарат, как альбендазол, который также лечит нематодные инфекции; однако требование 5-дневного дозирования затруднило бы завершение терапии во многих ситуациях.

В условиях, при которых базовый уровень питания ребенка превосходен, например, в детских садах в развитых странах, бессимптомным носителям может не всегда потребоваться терапия 5, 121, 195, 203, 221, 237.Однако следует отметить, что бессимптомно инфицированные дети могут выделять Giardia в течение 195 месяцев, нести его домой членам семьи и, таким образом, инициировать заражение в домашнем хозяйстве и даже способствовать поддержанию высокого уровня инфекции Giardia в сообществе 4, 196, 224; GD Overturf, Editorial, Clin. Заразить. Дис. 18: 764–765, 1994). Нередко у матери маленького ребенка, находящегося в дневном стационаре, появляются симптомы лямблиоза, определяя наличие в домашнем хозяйстве Giardia , который был занесен бессимптомным ребенком.При рецидивирующей диарее, связанной с Giardia , в дневном стационаре, которую нельзя контролировать с помощью улучшения гигиены, лечения и исключения детей с симптомами, можно рассмотреть вопрос о скрининге и лечении всех детей в дневном стационаре 5, 18. , 230.

При обнаружении Giardia в стуле и маловероятности повторного заражения, например, у вернувшегося путешественника, можно назначить лечение. В домашнем хозяйстве, если у одного члена есть симптомы и существует вероятность фекально-орального распространения внутри семьи или наличия общего источника инфекции, все члены семьи должны пройти обследование и лечение, чтобы не произошло повторного заражения.

Другим фактором, который следует учитывать при принятии решения о лечении бессимптомных носителей, являются последствия передачи инфекции, если носитель не лечится, например, заражение работников пищевых продуктов 169, 199. Эту группу следует лечить, чтобы предотвратить вспышки пищевого происхождения.

Резистентность и рецидив.

Сообщалось о неэффективности лечения всеми распространенными препаратами против Giardia , включая метронидазол, хинакрин, фуразолидон и альбендазол. Тем не менее, для клинициста, сталкивающегося с рецидивом симптомов после терапии, важно различать действительную лекарственную устойчивость, излечение с последующим повторным инфицированием и пост- Giardia непереносимость лактозы.Таким образом, первым шагом является документирование истинной персистирующей инфекции путем отправки образца стула на исследование O&P или обнаружение антигена Giardia . Если проба положительна, тщательный анамнез контакта должен предоставить информацию о вероятности повторного заражения, а повторно инфицированные лица должны реагировать на первоначальное терапевтическое средство. Повторное заражение будет обычным явлением в эндемичных регионах по всему миру и в условиях плохой фекально-оральной гигиены. Если у пациента произошло повторное инфицирование, следует выявить факторы риска и проконсультировать пациента относительно правильных мер гигиены и профилактики.

Непереносимость лактозы после введения Giardia является наиболее частым дефицитом дисахаридазы, связанным с лямблиозом, и может возникать у 20–40% пациентов 65. должны быть установлены продукты питания и жидкости. Этот синдром может занять несколько недель, чтобы решить.

Истинная неудача лечения может означать заражение лекарственно-устойчивым изолятом Giardia . Резистентность к большинству агентов против Giardia была задокументирована или индуцирована in vitro 29, 154, 245–247, а также к множеству генотипически различных клонов G.lamblia с чувствительностью к различным классам препаратов были обнаружены в двенадцатиперстной кишке человека 46, 81, 160, 248. Однако не было выявлено последовательной корреляции между резистентностью или чувствительностью in vitro и клинической неудачей или успехом 43, 160, 164, 225, 249, по-прежнему оставляя открытым вопрос об истинной резистентности к паразитам.

Клинически резистентные штаммы лечили более длительными повторными курсами или более высокими дозами исходного агента 91, 165, 178. Однако наиболее эффективным средством искоренения этих инфекций, по-видимому, является использование препарата другого класса, чтобы избежать потенциального перекрестного заражения. сопротивление 52, 92.Первоначальный переход на препарат другого класса не всегда может быть эффективным, как это было продемонстрировано у двух французских пациентов, у которых лечение альбендазолом было неудачным после двух курсов метронидазола, но был ответ на хинакрин (P. Brasseur and L. Favennec, Letter, Parasite 2: 422, 1995). Комбинированные режимы с использованием метронидазола-альбендазола, метронидазола-хинакрина или других активных препаратов или назначение нитроимидазола плюс хинакрина курсом не менее 2 недель доказали свою эффективность при рефрактерной инфекции 44, 182a, 197, 225, 234.Иногда для эффективного лечения потребуются несколько различных комбинаций или подходов.

В случаях лямблиоза, при котором альтернативная терапия неэффективна, следует рассмотреть другие возможности, например наличие иммунологической недостаточности. Хронический лямблиоз у пациентов с гипогаммаглобулинемией хорошо регистрируется 106, 108, 216 и может быть трудно поддающимся лечению, часто требующим длительных курсов терапии. Хотя Giardia наблюдается у гомосексуальных мужчин, занимающихся орально-анальной сексуальной практикой 162, 200, 226, болезнь часто может быть ни тяжелой, ни продолжительной 148.Тем не менее, у больных СПИДом с тяжелым лямблиозом может потребоваться пролонгированная или комбинированная терапия 182a.

Границы | Рециркуляция группы A Giardia lamblia после лечения метронидазолом в области с группами A, B и E Симпатрическая циркуляция

Введение

Giardia lamblia представляет собой жгутиковое простейшее, инфицирующее тонкий кишечник широкого спектра млекопитающих-хозяев. Передается фекально-оральным путем, что тесно связано с плохими санитарными условиями.Согласно недавним исследованиям, более 183 миллионов человек инфицированы Giardia в мире (Torgerson et al., 2015).

Филогенетически G. lamblia делится на восемь сообществ, обозначенных в алфавитном порядке от A до H. Люди в основном заражаются сообществами A и B (Adam, 2001; Feng and Xiao, 2011; Cacciò et al., 2018). Присутствие комплекса E также было обнаружено, хотя и с гораздо меньшей частотой, чем A и B (Fantinatti et al., 2016; Scalia et al., 2016; Захеди и др., 2017). Специфические характеристики каждой из различных групп повышают вероятность уникальных факторов, связанных с вирулентностью, патогенезом и чувствительностью к лекарственным средствам. Однако, поскольку инфекция часто протекает бессимптомно, диагностика и лечение инфицированных людей могут быть затруднены.

В Бразилии основным классом препаратов, рекомендуемых для лечения лямблиоза, является 5-нитроимидазол. Несмотря на свою эффективность, препараты 5-нитроимидазола имеют ряд побочных эффектов (Gardner and Hill, 2001).Наиболее часто используемым препаратом является метронидазол из-за его низкой стоимости и легкого доступа. Хотя лечение метронидазолом, по-видимому, эффективно при большинстве инфекций, появляются доказательства увеличения частоты терапевтической неудачи (Tejman-Yarden and Eckmann, 2011; Leitsch, 2015). В Лондоне, Великобритания, сообщалось о чрезмерном росте персистирующей паразитарной инфекции после лечения 5-нитроимидазолом за период с 2008 по 2013 год, когда терапевтическая неудача увеличилась с 15.от 1 до 40,2% (Nabarro et al., 2015). Это очевидное увеличение можно объяснить рядом причин, таких как неадекватные дозировки, неполные схемы лечения, иммуносупрессия или лекарственная устойчивость (Lemée et al., 2000; Gardner and Hill, 2001; Nash et al., 2001; Escobedo et al., 2014).

В Бразилии инфекция Giardia распространяется по всей стране, и оценочная точечная распространенность может достигать более 50% в районах с социальной и санитарной уязвимостью (Coelho et al., 2017). Это указывает на то, что скорость передачи паразита высока.С другой стороны, на сегодняшний день случаи персистирующей инфекции неизвестны. Мы предполагаем, что биологические характеристики каждой из циркулирующих групп могут влиять на их обнаруженную заболеваемость и чувствительность к лекарственным средствам. Настоящее исследование было предпринято для изучения циркуляции групп G. lamblia в районе с высокой распространенностью инфекции после лечения паразитированных особей метронидазолом.

Материалы и методы

Сбор проб, диагностика и лечение паразитов

Исследование проводилось в детском саду, расположенном в экономически неблагополучном районе Рио-де-Жанейро, Бразилия.В общей сложности 194 ребенка в этом детском саду в возрасте от 10 месяцев до 4 лет были обследованы в течение 2 лет. Ребенок был включен в исследование только после того, как родитель принял приглашение к участию и подписал Условия свободного и осознанного согласия, которые были одобрены Институциональным советом по этике (номер CAAE: 19705613.9.0000.5248) и включали полное раскрытие преимуществ и рисков. . У каждого пациента был собран один первоначальный образец стула для диагностики геогельминтов и простейших.Образцы фекалий подвергались паразитологическому исследованию по методикам Ритчи и Като-Каца. Кроме того, была проведена молекулярная диагностика с помощью ПЦР для выявления присутствия ДНК Giardia (см. ниже).

Лица с положительным диагнозом на патогенные паразиты получали лечение в соответствии с рекомендациями Министерства здравоохранения Бразилии. При инфекциях Giardia пациентам назначали метронидазол в дозе 15 мг/кг/сут перорально (максимум 250 мг) в течение 5 или 7 дней в случае неэффективности лечения.Примерно через 20–35 дней после лечения брали новый образец для определения контроля излечения. Лица, у которых оставался положительный результат, подвергались второму циклу лечения метронидазолом, а затем повторно оценивались через 20 дней (второй контроль лечения). Методология диагностики образцов вылеченного контроля была такой же, как и при первом исследовании.

Экстракция ДНК и молекулярная характеристика

G. lamblia

Образцы хранились при температуре -20°C до проведения молекулярной диагностики и характеризации.Выделение ДНК из кист проводили непосредственно из стула с помощью мини-набора QIAamp DNA Stool (Qiagen, Германия), в основном в соответствии с инструкциями производителя. Двумя исключениями были температура лизиса, которая была увеличена до 95°C, и объем буфера АЕ, используемого для элюирования ДНК, который был уменьшен до 100 мкл. Выделенную ДНК хранили при -20°С до момента использования.

Для генотипирования G. lamblia использовали области консервативных генов, кодирующих глутаматдегидрогеназу ( gdh ) и бета-гиардин (β -gia ).Экстрагированную ДНК подвергали ПЦР и гнездовой ПЦР (вторичной ПЦР) в конечном объеме 50 мкл реакции, содержащей 1X ПЦР-буфер, 3 мМ MgCl 2 , 2,5 ед. ДНК-полимеразы Taq (Invitrogen Life Technologies, Бразилия), 200 мкМ трифосфатдезоксирибонуклеотидов dNTP (Invitrogen Life Technologies, Бразилия) и по 0,2 мкМ каждого праймера.

Для амплификации мишени gdh в первичной ПЦР использовали праймеры: GDH 1 (TTCCGTRTYCAGTACAACTC) и GDH 2 (ACCTCGTTCTGRGTGGCGCA), а во вторичной ПЦР: GDh4 (ATGACYGAGCTYCAGAGGCACGT) и GDh5 (GTGGCGCARGGCATGATGCA), согласно Cacciò et., 2008. Для амплификации мишени β -gia использовали праймеры в первичной ПЦР: G7 (AAGCCCGACGACCTCACCCGCAGTGC) и G759 (GAGGCCGCCCTGGATCTTCGAGACGAC) и во вторичной ПЦР: B-GIAF (GAACGAACGAGATCGAGGTCCG) и B-GIAR (CTCGACGAGCTTCGTGTT), согласно Cacciò et al., 2002 и Lalle et al., 2005, соответственно.

В качестве положительного контроля использовали экстракты ДНК из аксенических культур клона С6 штамма WB G. lamblia (АТСС 50803). Отрицательные контроли включали ДНК, выделенную из аксенических культур Entameba histolytica и Trichomonas vaginalis .Успешную амплификацию проверяли электрофорезом в агарозном геле при концентрации 1%.

продукта ПЦР для каждой пары праймеров очищали с помощью набора NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Германия) в соответствии с инструкциями производителя, за исключением времени инкубации в буфере NE, которое было увеличено до 5 мин. Очищенные продукты секвенировали в обоих направлениях в трех экземплярах с использованием набора BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, США).После осаждения реакции образцы анализировали в службе секвенирования платформы для секвенирования ДНК FIOCRUZ (Otto et al., 2007). Каждый эксперимент проводили в трехкратной повторности.

Полученные электрофореграммы были проанализированы на качество в программе Chromas 2.4. Характеристика последовательности была выполнена с использованием основного инструмента поиска локального выравнивания с использованием нуклеотида (BLASTn), и консенсус был получен с помощью программы сборки последовательности CAP3. Нуклеотидные последовательности gdh и β -gia из G.lamblia выравнивали по алгоритму CLUSTAL W (Thompson et al., 1994) в пакете Molecular Evolutionary Genetics Analysis (MEGA) 7.0 (Kumar et al., 2016).

Филогенетический анализ был выполнен с использованием программы MEGA 7.0, а используемая оценка расстояния была основана на уравнении Jin and Nei (1990) с использованием 2-параметров модели Kimura). Последовательности новых изолятов в клинических образцах были выровнены с использованием GenBank последовательностей G. lamblia , принадлежащих наборам A, B и E.В качестве внешних групп использовались последовательности из G. psittaci , G. muris и T. vaginalis . Соответствующие инвентарные номера последовательностей указаны между вертикальными чертами на филогенетических деревьях. Кроме того, последовательности фрагментов гена gdh и β -gia были конкатенированы, и сообщалось о начальной загрузке выше 60%.

Было построено

филогенетических дерева с использованием алгоритма объединения соседей (Saitou and Nei, 1987). Наилучшая статистическая модель была определена по наименьшему значению BIC, найденному в MEGA (Kumar et al., 2016), где для обоих генов был выбран параметр Kimura 2. Для каждой конструкции достоверность каждой ветви определялась доверительным пределом с помощью бутстрап-анализа (1000 повторений) (Felsenstein, 1985). Характеристика последовательности G. lamblia , полученная из GenBank и использованная в качестве эталона для построения филогенетического дерева генов gdh и β -gia , представлена ​​в дополнительной таблице 2.

Программное обеспечение Recombination Detection Program версии 4 (RDP4) использовалось для проверки событий рекомбинации в наших изолятах из клинических образцов с использованием выравнивания конкатенированных последовательностей для генов gdh и β -gia (Martin et al., 2015). Существование уникальных событий рекомбинации было подтверждено несколькими методами (RDP, GENECONV, BootScan, MaxiChi, Chimera, SiScan и 3Seq).

Оценка последовательности нуклеотидов в

G. lamblia Трофозоиты, постоянно подвергавшиеся воздействию метронидазола in vitro

Трофозоиты Giardia lamblia из клона W6, штамм WB [ATCC50803], культивировали при 37°C в среде TYI-S-33 с pH 7,0, дополненной 10% инактивированной эмбриональной телячьей сыворотки (Cultilab, Campinas, Бразилия).Трофозоиты постоянно подвергались воздействию метронидазола (МТЗ) (Sigma Chemical Co., Сент-Луис, США) в течение как минимум 16 недель. Экспериментальные группы определяли по концентрации воздействия МТЗ: 1-я группа (МТЗ5) – 5 мкМ; группа (MTZ10) 2, 10 мкМ; группа 3 (MTZ20), 20 мкМ; группа 4 (СМТЗ) – без воздействия метронидазола; и группа 5 (CDMSO), обработанная 0,05% диметилсульфоксидом (Sigma, США), наполнителем для разбавления МТЗ. Концентрацию, необходимую для ингибирования роста паразитов на 50% (IC 50 ), определяли с использованием методологии, описанной Bénéré et al., 2007. Анализы для каждой экспериментальной группы проводились в трех экземплярах, и результаты IC 50 определялись с использованием программного обеспечения Prism 6.0 (GraphPad;). Тест ANOVA использовался для статистического анализа.

В конечной точке времени ДНК трофозоита G. lamblia экстрагировали с использованием ДНКазола (1 мл/10 7 паразитов; Invitrogen, Карлсбад, Калифорния, США). Последовательности gdh и β -gia были получены и проанализированы, как описано выше.

Результаты

Частота

Гс.lamblia Заражение и определение устойчивости паразитов после лечения

Всего было взято 194 образца стула у детей, 109 женщин и 85 мужчин. При первом обследовании были обнаружены следующие паразиты: Ascaris lumbricoides (15/194 – 7,73%), Entameba histolytica/dispar (4/194 – 2,06%), Entameba coli (5/194 – 2,58%). ), Endolimax nana (13/194 — 6,70%) и G. lamblia (86/194 — 44,33%) (дополнительная таблица 1).Всех индивидуумов, положительных на G. lamblia , лечили метронидазолом, и после лечения 36 человек оставались в исследовательской группе для оценки. Девятнадцать случаев представляли собой стойкую инфекцию после лечения и прошли второй цикл лечения метронидазолом. При определении второго контроля излечения повторно оценивали 18 человек. Из них у пятнадцати все еще был положительный диагноз на G. lamblia (рис. 1). Эти случаи индивидуально отслеживались для других клинических подходов.

Рисунок 1. Схематическое изображение положительности на Giardia lamblia в образцах фекалий детей в разные периоды исследования. Количество образцов, полученных в течение трех моментов оценки исследования ( Giardia ПЦР-отбор, 1-й контроль отверждения и 2-й контроль отверждения). Gia–: Образцы с отрицательным диагнозом на Giardia с помощью ПЦР; Gia+: Образцы с положительным диагнозом на Giardia с помощью ПЦР.

Генотипирование

G.lamblia , циркулирующие у дошкольников до и после лечения

ДНК G. lamblia , выделенная от 86 детей с положительным результатом при первоначальном диагнозе, была генотипирована с использованием как gdh , так и β- gia в качестве мишеней. Мы наблюдали большую генетическую изменчивость среди изолятов из образцов. Из консенсусных последовательностей образцы были сгруппированы следующим образом: 40 изолятов в наборе A, 21 изолят в наборе B, 17 изолятов в наборе E и 4 изолята, демонстрирующих характеристики обоих наборов A и E (рис. 2, 3).Многие различия наблюдались в подкомплексах, характеризующих AI и AII.

Рисунок 3. Филогенетическое дерево изолятов Giardia lamblia , собранных у детей до и после лечения, с помощью алгоритма объединения соседей с использованием двухпараметра Кимуры. (A) Филогенетическое дерево, основанное на последовательностях гена глутаматдегидрогеназы . (B) Филогенетическое дерево, основанное на последовательностях гена бета-гиардина .Последовательности названий обозначаются их инвентарными номерами. Красный ромб: CC1: изолировать из образца первого контроля отверждения и CC2: изолировать из образца второго контроля отверждения.

После первого контрольного обследования 36 диагностированных случаев все еще были положительными на инфекцию Giardia и были повторно оценены. На основании первоначального определения группы набора 19 изолятов были из набора А, 5 изолятов из набора В, 9 изолятов из набора Е и 3 изолята из набора А/Е.После второго курса лечения 13 из 19 детей с набором А, 2 из 5 детей с набором В, 2 из 9 детей с набором Е и 2 из 3 детей с набором А/Е оставались положительными. Генотипирование показало, что 18 из них были сгруппированы как сборка А (таблица 1, рисунок 3 и дополнительный рисунок 1). Любопытно, что сборки B или E не были обнаружены среди положительных людей (рисунок 2 и дополнительный рисунок 1).

Таблица 1. Giardia lamblia Совокупности, обнаруженные при первом диагнозе и после лечения.

Среди индивидуумов, инфицированных комплексом А (11 субъектов) при первой оценке и в первом контроле лечения, 9 изолятов демонстрировали 100% идентичность между изолятами из образцов до и после лечения для двух использованных генных мишеней ( gdh и β — gia ). Три человека представили генотипическую дивергенцию между изолятами из первой проанализированной оценки и первого контрольного лечения. Два показали различия в гене β -gia , а другие показали различия в мишени gdh .

После 2-го курса лечения 15 случаев оставались положительными, при этом 13 изолятов были сгруппированы в группу А, что включало идентификацию уникальной группы. Все последовательности из второго контроля лечения показали 100% идентичность с последовательностью того же индивидуума в первом контроле лечения.

Три образца, которые были положительными после лечения, один из 1-й контрольной группы лечения и два из 2-й контрольной группы лечения, были амплифицированы, но не охарактеризованы.Три других изолята были генотипированы только на основе гена gdh .

Среди лиц, которые представили изоляты, сгруппированные как набор А в первом исследовании и в последующих контролях лечения, 8 случаев показали 100% идентичность изолятов во все три момента анализа.

При использовании RDP4 количество возможных уникальных событий рекомбинации среди связанных последовательностей различалось в зависимости от метода обнаружения (RDP: 13, GENECONV: 15, BootScan: 9, MaxiChi: 9, Chimera: 11, SiScan: 20, 3Seq: 19) .В области гена β -gia было обнаружено несколько событий рекомбинации (RDP: 0, GENECONV: 1, BootScan: 0, MaxiChi: 1, Chimera: 1, SiScan: 1, 3Seq: 2). Наибольшее количество рекомбинаций наблюдалось в области гена gdh (RDP: 13, GENECONV: 9, BootScan: 6, MaxiChi: 6, Chimera: 6, SiScan: 9, 3Seq: 13). Оба изолята сборки B и сборки E представили одно событие рекомбинации. Демонстрация одного и того же филогенетического профиля среди изолятов из каждого кластера сборки. Все другие события рекомбинации наблюдались в сборке А для мишени gdh.

Никаких изменений в нуклеотидных последовательностях

gdh и β -gia Из G. lamblia Трофозоиты не наблюдались после in vitro Воздействие метронидазола

Значения IC 50 групп MTZ5, MTZ10 и MTZ20 были значительно выше, чем у контрольных групп SMTZ и CDMSO. Между группами не наблюдалось различий в нуклеотидных последовательностях (представлено Lopes-Oliveira et al.). Эти результаты показали, что, несмотря на серьезное влияние на выживание паразита, MTZ не вызывает изменений в оцениваемых консервативных генах.

Обсуждение

Передача G. lamblia более распространена в районах без элементарных санитарных условий (водоочистные и канализационные сети), что является реальностью в районах Бразилии с низким доходом. Внутривидовые и межвидовые контакты могут способствовать распространению лямблиоза (Feng and Xiao, 2011), что является реальностью в регионах с низким уровнем дохода, где кошки и собаки могут свободно бродить, а также может присутствовать домашний скот. Эти множественные источники могут увеличить риск заражения, наряду с повторным заражением G.lamblia и может объяснить высокую распространенность инфекции, наблюдаемую в настоящем исследовании. Однако неизвестно, связан ли профиль сборки Giardia с инфекционным бременем.

Здесь были идентифицированы три группы G. lamblia (A, B и E), о которых сообщалось у людей. В нашем исследовании наблюдалась высокая скорость конвергенции между генами-мишенями ( gdh и β -gia ), использованными для генотипирования. Поскольку гены, используемые для генотипирования, считаются консервативными, ожидается хороший дискриминационный потенциал среди наборов (Ryan and Cacciò, 2013).Однако низкая вариабельность нуклеотидов, наблюдаемая среди субкомплексов А, ставит под сомнение эффективность этих генных мишеней для характеристики изолятов в основном в AI и AII (Lebbad et al., 2010, 2011; Ankarklev et al., 2018). Небольшие изменения нуклеотидов могут быть недостаточными или достаточными для дифференцировки в подгруппы. При использовании метода детекции для выявления возможных уникальных событий рекомбинации ген β -gia оказался более консервативным, чем ген gdh . Высокая скорость рекомбинации, наблюдаемая в сборке А гена gdh , указывает на высокую изменчивость среди изолятов этой сборки в этом исследовании.Это оправдывает расхождение в характеристиках субкомплексов AI и AII в генах-мишенях. Могли происходить события рекомбинации между подгруппами AI и AII и между ассоциациями A и E (Xu et al., 2012; Ankarklev et al., 2018). Мы обнаружили четыре случая несоответствия между наборами А и Е, но в этом исследовании не наблюдалось никаких событий рекомбинации. Обычно сообщается об этом несоответствии между комплексами (Cacciò et al., 2008).

Частота сборки А была выше по сравнению с В или Е.Несколько сообщений о сообществах Giardia в Бразилии указывают на региональные различия в распространенности преобладающего циркулирующего сообщества (Coelho et al., 2017). В Рио-де-Жанейро у людей чаще всего идентифицировали комплекс А (Volotão et al., 2007; Fantinatti et al., 2016), хотя набор B (Faria et al., 2016) и набор E (Fantinatti et al. , 2016) уже сообщалось. Настоящие результаты согласуются и подтверждают опубликованный эпидемиологический профиль скоплений Giardia в нашем регионе.

В нашем предыдущем исследовании, проведенном в этом регионе, был идентифицирован комплекс E и особенно комплекс A (Fantinatti et al., 2016). Полученные здесь результаты показывают, что циркуляция этих сообществ все еще актуальна, а набор А распространяется в окружающей среде благодаря домашним животным (Volotão et al., 2007; Fantinatti et al., 2018). Тем не менее, идентификация комплекса В, циркулирующего у инфицированных детей, не была подтверждена, хотя первая идентификация комплекса В в Рио-де-Жанейро была зарегистрирована в тот же период (Faria et al., 2016). Дальнейшие исследования образцов из окружающей среды могут помочь понять преобладание комплекса A.

.

В Бразилии наиболее часто используемым службой здравоохранения для лечения лямблиоза препаратом является метронидазол, и в большинстве случаев лечение оказывается эффективным. Однако фактическая частота терапевтической неудачи метронидазола в Бразилии до сих пор неизвестна. Наблюдаемый нами уровень продолжающейся инфекции после лечения метронидазолом считался высоким, поскольку 19 из 36 повторно обследованных детей были инфицированы при первом контроле лечения.Это продолжалось после второго контрольного лечения, где 15 из 18 были положительными. Положительные случаи в контроле лечения могут быть результатом терапевтической неудачи (субдоза препарата, резистентность к паразитам) или повторного заражения (Argüello-García et al., 2004).

Отрицательные результаты лечения метронидазолом, скорее всего, являются терапевтическим успехом. Это событие наблюдалось у лиц, инфицированных тремя различными комплексами. Было высказано предположение, что определенная совокупность может быть связана с длительным течением лямблиоза и случаями сохранения инфекции после лечения (Mørch et al., 2008). Ни один из изолятов из контрольных образцов лечения не был генотипирован как группа B или E. Это может указывать на то, что лечение было эффективным для элиминации этих групп. Однако утверждать, что эти сборки (Б и Е) более чувствительны к действию МТЗ, чем группа А, нельзя. Поскольку клонирование генов в данном исследовании не проводилось, исключить коинфекцию нельзя и была выявлена ​​только одна ассоциация с помощью реакций секвенирования по SANGER.

Поскольку в изучаемом сообществе плохие жилищные условия и плохие элементарные санитарно-гигиенические условия, основная гипотеза состоит в том, что случаи персистентных инфекций являются результатом последовательных инфекций.Это подтверждается теми случаями, когда совокупность, идентифицированная после цикла лечения, отличалась от первой оценки. Сборка А была единственной совокупностью, идентифицированной при 1-м и 2-м контроле отверждения. Учитывая высокую распространенность комплекса А в районе нашего исследования, наиболее вероятно, что повторное заражение будет именно этим комплексом. За исключением трех образцов, между последовательностями, оцененными до и после у одного и того же человека, наблюдалась 100% идентичность. Хотя повторное заражение той же ассоциацией не может быть исключено через короткий промежуток времени, в районе нашего исследования реинфекция была ожидаема примерно у половины детей, инфицированных ассоциацией В или Е в контроле лечения (по данным первого обследования).Это предполагает, что следует учитывать терапевтическую неудачу и резистентность.

Как упоминалось выше, у трех человек, у которых после цикла лечения сохранялся положительный результат на комплекс А, наблюдалась генотипическая дивергенция между первым проанализированным образцом и первым контрольным образцом лечения. Изменения нуклеотидов, вероятно, не были следствием обработки, поскольку эти мишени не были изменены, когда трофозоитов Giardia подвергались воздействию различных концентраций MTZ in vitro.Это говорит о том, что эти люди были инфицированы другим штаммом того же комплекса, но с другим подтипом.

Находки в районе нашего исследования позволяют предположить, что дети в течение длительного времени остаются инфицированными G. lamblia . Частые эпизоды повторного заражения и персистенции паразитов были замечательными открытиями в районе нашего исследования. В районах с высокой частотой заражения и реинфекции также ожидается частое применение метронидазола. Однако пока невозможно определить, были ли рецидивирующие случаи связаны с лекарственной устойчивостью паразитов.Продолжительное заражение паразитом Giardia может вызвать снижение уровня жирорастворимых витаминов и стеаторею, а также задержку роста. Воздействие лямблиоза на развитие ребенка усиливает серьезность этого типа инфекции как проблемы общественного здравоохранения, которая, хотя в основном незаметна и не привлекает внимания общественности, требует более пристального внимания. Настоящие результаты поднимают вопрос для районов с высокой частотой заражения: может ли лечение лямблиоза подвергать детей дополнительным неблагоприятным последствиям препарата, одновременно маскируя необходимость мер борьбы с паразитами, которые требуют изменений в государственной политике для поощрения инвестиций в улучшение санитарные условия.

Заявление о доступности данных

Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях. Названия репозитория/репозиториев и инвентарные номера можно найти в статье/дополнительных материалах.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены Этическим комитетом Института Освальдо Круза (CEP FIOCRUZ/IOC). Письменное информированное согласие на участие в этом исследовании было предоставлено законным опекуном/ближайшим родственником участников.

Вклад авторов

MF: концептуализация, методология, получение финансирования и написание рукописи. ЛЛ-О: методология. TC-F: методология. ПА-Т: методология. ЭВ: методология. АБ: формальный анализ. AD-C: концептуализация, получение финансирования и написание рукописи. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Эта работа была поддержана внутренним финансированием Instituto Oswaldo Cruz (PAEF II-IOC-23-FIO-18-2-53), CNPq (Universal — 435015/2018-4).MF получил финансирование от Universal/CNPq (435015/2018-4). MF был поддержан стипендией от CAPES (Brasil Sem Miséria/Бразильская правительственная программа) и CNPq (PDJ). AD-C имеет исследовательскую стипендию от CNPq и FAPERJ (CNE).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы глубоко благодарны Элизабет Сальгадо и команде детского сада за их безоговорочную поддержку в наборе детей, а также команде Clinica da Familia из CMS Heitor Beltrão-SMS-RJ за клиническую помощь.Мы в долгу перед доктором У. Провансом за его ценный критический обзор и издание на английском языке. Мы хотим поблагодарить Платформу секвенирования ДНК службы секвенирования — Fundação Oswaldo Cruz. Наконец, мы благодарны доктору Октавио Фернандесу за то, что он предоставил нам основу для этого направления исследований.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2020.571104/full#supplementary-material

.

Сноски

Каталожные номера

Адам, Р.Д. (2001). Биология Giardia lamblia . клин. микробиол. Версия . 14, 447–475.

Академия Google

Анкарклев, Дж., Леббад, М., Эйнарссон, Э., Франзен, О., Ахола, Х., Троелл, К., и соавт. (2018). Новое мультилокусное типирование последовательности с высоким разрешением изолятов группы А Giardia кишечная выявляет зоонозную передачу, клональные вспышки и рекомбинацию. Заразить. Жене. Эвол. 60, 7–16. doi: 10.1016/j.meegid.2018.02.012

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Аргуэлло-Гарсия, Р., Крус-Сото, М., Ромеро-Монтойя, Л., и Ортега-Пьеррес, Г. (2004). Изменчивость и вариабельность чувствительности к лекарственным препаратам среди изолятов и клонов Giardia duodenalis , подвергшихся воздействию 5-нитроимидазолов и бензимидазолов in vitro . J. Антимикроб. Чемотер. 54, 711–721. doi: 10.1093/jac/dkh488

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бенере Э., да Луз Р. А., Вермеерш М., Кос П. и Маес Л. (2007). Новый количественный метод микрокультуры in vitro для Giardia duodenalis трофозоитов. J. Microbiol. Методы 71, 101–106. doi: 10.1016/j.mimet.2007.07.014

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Cacciò, S.M., Beck, R., Lalle, M., Marinculic, A., and Pozio, E. (2008). Мультилокусное генотипирование Giardia duodenalis выявляет поразительные различия между группами A и B. Int. Дж. Паразитол. 38, 1523–1531. doi: 10.1016/j.ijpara.2008.04.008

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Каччио, С.М., Де Джакомо М. и Позио Э. (2002). Анализ последовательности гена бета-гиардина и разработка анализа полиморфизма длины рестрикционного фрагмента полимеразной цепной реакции для генотипа цист Giardia duodenalis из образцов фекалий человека. Междунар. Дж. Паразитол. 32, 1023–1030. doi: 10.1016/s0020-7519(02)00068-1

Полнотекстовая перекрестная ссылка | Академия Google

Cacciò, S.M., Lalle, M., and Svärd, S.G. (2018). Специфичность хозяина в комплексе видов Giardia duodenalis . Заразить. Жене. Эвол. 66, 335–345. doi: 10.1016/j.meegid.2017.12.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коэльо, Ч. Х., Дуриган, М., Леал, Д. А. Г., Шнайдер, А. Б., Франко, Р. М. Б., и Сингер, С. М. (2017). Лямблиоз как запущенное заболевание в Бразилии: систематический обзор публикаций за 20 лет. PLoS Негл. Троп. Дис. 11:e0006005. doi: 10.1371/journal.pntd.0006005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Эскобедо, А.А., Ханевик К., Алмиралл П., Симерман С. и Альфонсо М. (2014). Лечение хронической инфекции Giardia . Эксперт Вер. Анти. Заразить. тер. 12, 1143–1157. дои: 10.1586/14787210.2014.942283

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фантинатти М., Белло А. Р., Фернандес О. и Да-Крус А. М. (2016). Идентификация Giardia lamblia комплекса E у человека указывает на новый антропозоонозный цикл. Дж. Заражение.Дис. 214, 1256–1259. doi: 10.1093/infdis/jiw361

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фантинатти, М., Касека, А.С., Белло, А.Р., Фернандес, О., и Да-Крус, А.М. (2018). Присутствие Giardia lamblia комплекса A у собак свидетельствует об антропозоонозном цикле паразита в Рио-де-Жанейро, Бразилия. Заразить. Жене. Эвол. 65, 265–269. doi: 10.1016/j.meegid.2018.07.025

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фариа, К.П., Занини Г.М., Диас Г.С., да Силва С. и Соуза М.К. (2016). Молекулярная характеристика Giardia lamblia : первое сообщение о сборке B в человеческих изолятах из Рио-де-Жанейро (Бразилия). PLoS One 11:e0160762. doi: 10.1371/journal.pone.0160762

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фельзенштейн, Дж. (1985). Пределы достоверности филогений: подход с использованием бутстрапа. Эволюция. 39, 783–791. дои: 10.2307/2408678

Полнотекстовая перекрестная ссылка | Академия Google

Гарднер Т.Б. и Хилл Д.Р. (2001). Лечение лямблиоза. клин. микробиол. Ред. 14, 114–128.

Академия Google

Джин Л. и Ней М. (1990). Ограничения эволюционно-экономного метода филогенетического анализа. Мол. биол. Эвол. 7, 82–102.

Академия Google

Кумар С., Стечер Г. и Тамура К. (2016). MEGA7: молекулярно-эволюционный генетический анализ версии 7.0 для больших наборов данных. Мол. биол. Эвол. 33, 1870–1874 гг. doi: 10.1093/molbev/msw054

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лалле, М., Поцио, Э., Капелли, Г., Бруски, Ф., Кротти, Д., и Качио, С. М. (2005). Генетическая гетерогенность локуса бета-гиардин среди изолятов человека и животных Giardia duodenalis и идентификация потенциально зоонозных субгенотипов. Междунар. Дж. Паразитол. 35, 207–213. doi: 10.1016/j.ijpara.2004.10.022

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Леббад, М., Маттссон, Дж. Г., Кристенссон, Б., Юнгстрем, Б., Бэкханс, А., Андерссон, Дж. О., и соавт. (2010). От мыши к лосю: мультилокусное генотипирование изолятов Giardia от различных видов животных. Вет. Паразитол. 168, 231–239. doi: 10.1016/j.vetpar.2009.11.003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Леббад, М., Петерссон, И., Карлссон, Л., Botero-Kleiven, S., Andersson, J.O., Svenungsson, B., et al. (2011). Мультилокусное генотипирование человеческих изолятов Giardia предполагает ограниченную зоонозную передачу и связь между комплексом B и метеоризмом у детей. PLoS Негл. Троп. Дис. 5:e1262. doi: 10.1371/journal.pntd.0001262

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Леме В., Захария И., Невез Г., Рабодонирина М., Брассер П., Балет Дж. Дж. и др. (2000). Чувствительность к метронидазолу и альбендазолу 11 клинических изолятов Giardia duodenalis из Франции. J. Антимикроб. Чемотер. 46, 819–821. doi: 10.1093/jac/46.5.819

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мартин Д. П., Мюррелл Б., Голден М., Хусал А. и Мухире Б. (2015). RDP4: обнаружение и анализ закономерностей рекомбинации в геномах вирусов. Эволюция вируса. 1:vev003.

Академия Google

Мёрх, К., Ханевик, К., Робертсон, Л.Дж., Странд, Э.А., и Лангеланд, Н. (2008). Лестница лечения и генетическая характеристика паразитов при рефрактерном лямблиозе после вспышки в Норвегии. Дж. Заражение. 56, 268–273. doi: 10.1016/j.jinf.2008.01.013

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Набарро, Л. Э., Левер, Р. А., Армстронг, М., и Чиодини, П. Л. (2015). Повышение заболеваемости лямблиозом, устойчивым к нитроимидазолу, в больнице тропических болезней, Лондон, 2008–2013 гг. клин. микробиол. Заразить. 21, 791–796. doi: 10.1016/j.cmi.2015.04.019

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нэш, Т.Э., Ол, К.А., Томас, Э., Субраманиан, Г., Кайзер, П., и Мур, Т.А. (2001). Лечение больных рефрактерным лямблиозом. клин. Заразить. Дис. 33, 22–28. дои: 10.1086/320886

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Отто, Т. Д., Катаньо, М., Дегрейв, В., и де Миранда, А. Б. (2007). Платформа биоинформатики PDTIS: от последовательности к функции. Ред. Электрон. коммун. Инф. Инов. Сауде 1, 286–294.

Академия Google

Райан, У.и Cacciò, SM (2013). Зоонозный потенциал Giardia. Междунар. Дж. Паразитол. 43, 943–956.

Академия Google

Сайтоу, Н., и Ней, М. (1987). Метод соседнего соединения: новый метод реконструкции филогенетических деревьев. Мол. биол. Эвол. 4, 406–425.

Академия Google

Scalia, L.A., Fava, N.M., Soares, R.M., Limongi, J.E., da Cunha, M.J., Pena, I.F., et al. (2016). Мультилокусное генотипирование Giardia duodenalis у бразильских детей. Пер. Р. Соц. Троп. Мед. Гиг. 110, 343–349.

Академия Google

Томпсон, Дж. Д., Хиггинс, Д. Г., и Гибсон, Т. Дж. (1994). CLUSTAL W: повышение чувствительности прогрессивного множественного выравнивания последовательностей за счет взвешивания последовательностей, штрафов за пробелы для конкретных позиций и выбора матрицы весов. Рез. нуклеиновых кислот. 22, 4673–4680. doi: 10.1093/нар/22.22.4673

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Торгерсон, П.R., Devleesschauwer, B., Praet, N., Speybroeck, N., Willingham, A.L., Kasuga, F., et al. (2015). Оценки Всемирной организации здравоохранения глобального и регионального бремени 11 паразитарных болезней пищевого происхождения, 2010 г.: обобщение данных. PLoS Мед. 12:e1001920. doi: 10.1371/journal.pmed.1001920

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Волотао, А. К., Коста-Маседо, Л. М., Хаддад, Ф. С., Брандао, А., Перальта, Дж. М., и Фернандес, О. (2007). Генотипирование Giardia duodenalis из образцов человека и животных из Бразилии с использованием гена бета-гиардина: филогенетический анализ. Acta Trop. 102, 10–19. doi: 10.1016/j.actatropica.2007.02.010

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сюй, Ф., Джерлстрём-Хультквист, Дж., и Андерссон, Дж. О. (2012). Полногеномный анализ рекомбинации позволяет предположить, что комплексов Giardia кишечная представляют разные виды. Мол. биол. Эвол. 29, 2895–2898. doi: 10.1093/molbev/mss107

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Захеди, А., Филд Д. и Райан У. (2017). Молекулярное типирование Giardia duodenalis у людей в Квинсленде – первое сообщение о сборке E. Parasitology 144, 1154–1161. дои: 10.1017/s0031182017000439

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лямблиоз | Michigan Medicine

Обзор темы

Что такое лямблиоз?

Лямблиоз (скажем, «джи-ар-дай-э-э-э-э-э-э-э») — кишечная инфекция, вызываемая паразитом Giardia lamblia .

Болезнь, также называемая лямблией (скажем, «джи-АР-ди-э»), чаще всего является проблемой в неразвитых странах, где водопроводная вода небезопасна.

Как можно заразиться лямблиями?

Вы можете заразиться лямблиями, если съедите пищу или выпьете воду, загрязненную человеческими или животными экскрементами. В США и Канаде лямблиями можно заразиться, выпив неочищенную воду из колодцев, ручьев, рек и озер. Это верно даже в горных озерах и ручьях, где вода может показаться очень чистой.Инфекция также может произойти, если вы проглотите зараженную воду во время плавания.

Вы можете заразиться лямблиями от другого человека через:

  • Тесный контакт с инфицированным человеком.
  • Работа в детских садах для детей раннего возраста. Например, если вы меняете подгузник и не моете руки после этого, все, к чему вы прикасаетесь, может заразиться. Вы даже можете заболеть сами, если прикоснетесь ко рту или съедите пищу, к которой прикасались. Дети в детских садах также более подвержены заражению.
  • Работа или проживание в домах престарелых или других центрах по уходу, где люди могут иметь плохой контроль кишечника и плохую гигиену.
  • Некоторые виды полового контакта, например анально-оральный контакт.

Каковы симптомы?

Лямблии могут вызывать диарею, спазмы желудка, газы и тошноту. Вы можете чувствовать себя плохо один раз, а затем поправиться. Или ваши симптомы могут появляться и исчезать в течение некоторого времени. Некоторые дети с лямблиозом не растут или не набирают вес нормально.Иногда лямблиоз не вызывает никаких симптомов.

После того, как человек подвергся воздействию паразита, для развития инфекции обычно требуется от 7 до 10 дней, но это может занять от 3 до 25 дней или дольше. Вы можете передать инфекцию другим в течение всего времени, пока вы инфицированы. Вы можете быть инфицированы в течение нескольких месяцев, даже если у вас нет симптомов.

Как это диагностируется?

Ваш врач задаст вопросы о вашем прошлом здоровье и проведет медицинский осмотр, чтобы выяснить, есть ли у вас лямблиоз.Он или она может также проверить ваш стул на наличие паразита, вызывающего инфекцию.

Как лечится?

Ваш врач может прописать лекарство для уничтожения паразита. Лечение также снижает вероятность того, что вы передадите лямблии другим. Важно принимать лекарство так долго, как это предписано, чтобы инфекция не вернулась.

В некоторых случаях вас могут проверить на лямблиоз, даже если у вас нет никаких симптомов. Например, это может произойти во время вспышки в детском саду.

Если у вас диарея, попробуйте есть небольшие количества мягкой пищи, пока не почувствуете себя лучше. Это дает вашему кишечнику отдых. Но вам нужно делать частые глотки прозрачных жидкостей, таких как напитки для регидратации, чтобы избежать обезвоживания. Это особенно важно для детей, потому что они могут быстро обезвоживаться.

У некоторых людей с лямблиозом возникают временные проблемы с перевариванием молока и молочных продуктов. Это называется непереносимостью лактозы. Если у вас есть эта проблема, избегайте этих продуктов в течение как минимум 1 месяца.Затем медленно добавляйте их обратно в свой ежедневный рацион, пока ваше тело не справится с ними.

Можно ли предотвратить лямблиоз?

Есть несколько способов избежать лямблиоза.

  • Не пейте неочищенную или неочищенную воду. Если вы отправляетесь в поход или путешествуете пешком, кипятите или очищайте воду из озер и ручьев, прежде чем пить ее.
  • Когда вы путешествуете в зонах повышенного риска, пейте бутилированную воду и избегайте сырых фруктов и овощей. Не пейте напитки, содержащие кубики льда.
  • Чаще мойте руки, чтобы не заразиться лямблиозом от инфицированного человека. Это очень важно не только после смены подгузников, посещения туалета или помощи кому-то еще в туалете, но и перед приготовлением еды.

Лямблиоз — причины, симптомы, лечение, диагностика

Факты

Лямблиоз представляет собой кишечную инфекцию, вызываемую микроскопическим одноклеточным паразитом, известным как Giardia lamblia . Паразит — это организм, который живет на или внутри другого организма, называемого хозяином. Лямблиоз, обычно встречающийся в озерах, ручьях или прудах, загрязненных фекалиями человека, ондатр, собак или бобра, также известен как «бобровая лихорадка».

Giardia lamblia — одна из наиболее распространенных паразитарных инфекций человека в Канаде. Большее количество инфекций наблюдается в конце летних месяцев, и даже сообщается о нескольких смертельных случаях.

Путешественники в регионы Африки, Азии и Латинской Америки, где запасы чистой воды ограничены, подвергаются повышенному риску заражения инфекцией.

Некоторые здоровые люди не заболевают Giardia lamblia ; однако они все еще могут передавать инфекцию другим. Дети, пожилые люди и люди с длительными заболеваниями могут быть особенно склонны к заражению этой болезнью, поскольку риск передачи выше в детских садах, учреждениях по уходу за хроническими больными и в домах престарелых.

Причины

Паразит, вызывающий лямблиоз, живет в кишечнике инфицированных людей и животных .Он попадает в почву, воду, пищу или другие поверхности после дефекации. Наиболее частый способ заражения – употребление зараженной воды. Тем не менее, люди могут заразиться и при передаче инфекции из рук в рот. Это включает в себя употребление зараженной пищи или прикосновение к загрязненным поверхностям и неосознанное проглатывание паразита.

Паразиты образуют цисты (резистентные формы паразита), которые проглатываются. Затем кисты размножаются в кишечнике, вызывая признаки и симптомы лямблиоза.Затем паразиты образуют новые цисты, которые выделяются со стулом, продолжая жизненный цикл паразита. Проглатывание всего 10 цист достаточно, чтобы вызвать заболевание.

Симптомы и осложнения

Признаки и симптомы лямблиоза обычно проявляются в течение 7–14 дней после контакта с паразитом, хотя симптомы могут появиться уже через 3 дня или даже через 25 дней.

Они часто включают диарею, бледный жирный стул, желудочные спазмы, газы, тошноту, рвоту, вздутие живота, потерю веса и слабость.Некоторые люди могут испытывать взрывную диарею с неприятным запахом.

Лихорадка, сыпь и боль в суставах встречаются реже. Симптомы обычно длятся от 1 до 2 недель, но могут длиться до 6 недель.

У лиц с другими заболеваниями могут наблюдаться длительные симптомы, приводящие к таким осложнениям, как длительная диарея, ведущая к обезвоживанию, дальнейшей потере веса и недоеданию.

Другие осложнения включают артрит и повреждение клеток, выстилающих кишечник.

Постановка диагноза

Поскольку признаки и симптомы лямблиоза сходны со многими другими заболеваниями, врач попросит вас сдать анализ кала. Наличие или отсутствие цист (резистентная форма паразита, обнаруженная в стуле) или антигена паразита помогает определить, есть ли у вас заболевание. Этот тест можно повторить несколько раз в течение нескольких дней, чтобы подтвердить присутствие паразита.

Лечение и профилактика

В некоторых случаях лямблиоз проходит сам по себе примерно через месяц. Другие люди нуждаются в антибиотиках (например, метронидазол*), чтобы сократить продолжительность инфекции и убить паразита.

Поскольку болезнь может быстро распространяться, врач может предложить лечить всю семью одновременно. Ваш врач может также предложить вам принимать лекарства в течение более длительного времени или менять их в зависимости от тяжести вашего заболевания. Очень важно, чтобы вы сообщили своему врачу, если вы беременны, потому что некоторые лекарства, используемые для лечения этого состояния, могут нанести вред плоду.

Наконец, очень важно, чтобы вы пили достаточно воды и напитков, богатых электролитами (растворы, содержащие сахар и соли), потому что ваш организм будет терять воду из-за диареи. Признаки обезвоживания: крайняя усталость; сухость кожи, рта и языка; запавшие глаза; и очень небольшое производство мочи или слез.

Дети подвергаются более высокому риску обезвоживания, чем взрослые, из-за их небольшого размера тела, поэтому родители или опекуны должны следить за признаками обезвоживания и следить за тем, чтобы ребенок выпивал большое количество регидратирующего раствора.Растворы для пероральной регидратации, которые доступны в аптеках в виде жидкостей или пакетиков с порошком для смешивания с водой, являются отличным способом поддержания водного баланса у ребенка. Если вы смешиваете порошок электролита с водой, убедитесь, что вода чистая, чтобы избежать повторного заражения.

Существует несколько эффективных способов избежать заражения или распространения этой инфекции. Помните об этих советах:

  • Не пейте, не чистите зубы и не мойте продукты и посуду неочищенной водой из ручьев, рек или озер, даже если они выглядят блестящими.Обязательно кипятите воду из этих источников в течение 1–2 минут (или 3 минут, если вы находитесь на большой высоте) перед использованием.
  • Тщательно мойте руки водой с мылом до и после еды, приготовления пищи, смены подгузников и посещения туалета.
  • Не отправляйте инфицированного ребенка, который не может контролировать свою дефекацию, в детский сад или школу.
  • Не глотайте воду при плавании в общественных бассейнах или озерах. Хлор, обычно используемый в плавательных бассейнах, не убивает цисты.
  • Старайтесь есть хорошо приготовленную горячую пищу и всегда чистите сырые овощи и фрукты.

Авторские права на все материалы принадлежат MediResource Inc., 1996–2022 гг. Условия использования. Содержимое здесь предназначено только для информационных целей. Всегда обращайтесь за советом к своему врачу или другому квалифицированному поставщику медицинских услуг по любым вопросам, которые могут у вас возникнуть относительно состояния здоровья. Источник: www.medbroadcast.com/condition/getcondition/лямблиоз

Лямблиоз у животных — пищеварительная система

  • Устранение клинических признаков по сравнению с прекращением выделения кисты одобрен для лечения собак в большинстве стран Европы (хотя в некоторых странах только на 3 дня лечения) и может быть рекомендован для кошек.Сообщается, что он останавливает выделение цист Giardia у собак без побочных эффектов и безопасен для беременных и кормящих животных. Таким образом, фенбендазол считается препаратом первой линии для лечения, но метронидазол можно рассматривать либо отдельно, либо вместе с фенбендазолом, если клинические симптомы сохраняются. Однако, хотя сообщалось об успешном лечении собак метронидазолом (25 мг/кг каждые 12 часов или 50 мг/кг в день в течение 5 дней), и он лицензирован в большинстве европейских стран для лечения как собак, так и кошек, это было связано с серьезными побочными эффектами ЦНС у собак после длительного лечения или высоких доз.

    Альбендазол не рекомендуется применять у собак и кошек из-за возможного угнетения функции костного мозга. Также было показано, что комбинация празиквантела (5 мг/кг), пирантела (15 мг/кг) и фебантела (15 мг/кг) один раз в день в течение 3 дней эффективна для лечения собак и лицензирована в большинстве европейских стран, а также за пределами ЕС. Другие агенты также были опробованы экспериментально, особенно когда более обычные схемы лечения оказались безуспешными. К ним относятся, помимо прочего, азитромицин (10 мг/кг в сутки в течение 5 дней), нитазоксанид (75 мг/кг в сутки в течение 14 дней), тинидазол (50 мг/кг в сутки в течение 5 дней) , секнидазол (30 мг/кг, две разовые дозы с интервалом в 2 недели) и хлорохин (2.5 мг/кг каждые 12 часов в течение 5 дней). В целом, опубликованные отчеты о таких исследованиях показывают, что новое лечение оказалось успешным.

    Несмотря на отсутствие лицензированных методов лечения Giardia у домашнего скота, было показано, что как фенбендазол, так и альбендазол (5–20 мг/кг в день в течение 3 дней) уменьшают выделение кист у овец и крупного рогатого скота и обеспечивают некоторую клиническую пользу (уменьшение диареи и увеличение веса).

Добавить комментарий

Ваш адрес email не будет опубликован.